PROGRAM BOOK
Table of Content
page
Agenda
3
General Info
• Logistics Summary
7
• Venue & Hotel Addresses
9
• Shuttle Schedule
10
Index for Abstracts
11
Abstracts
14 - 154
11
TH
$SEA-PHAGES$SYMPOSIUM$
Friday,$June$7,$2019$
3:00$PM$–$4:30$PM $
CHECK-IN $
RECEPTION$DESK/GALLERY$
POSTER$SET-UP$
LOBBY$
STUDENT$PRESENTER$P RACTICE$PERIOD$
AUDITORIUM$
4:45$PM$–$6:15$PM $
STUDENT$DEBRIEFING$
AUDITORIUM$
5:00$PM$–$6:00$PM $
FACULTY$SOCIAL$&$ANNOUNCEMENTS$
LOBBY$
6:00$PM$–$7:15PM$
DINNER $
DINING $ROOM$
7:15$PM$–$7:30$PM $
WELCOME$AND$REMARKS$
STUDENTS$IN$AUDITORIUM$$
F
ACULTY$IN$SEMINAR$ROOM$
7:30$PM$–$8:45$PM $
KEYNOTE$I$
STUDENTS$IN$AUDITORIUM$$
F
ACULTY$IN$SEMINAR$ROOM$
Dr.$Pardis$Sabeti$
Harvard$University$&$HHMI$
8:45$PM$–$9:30$PM $
Social$
LOBBY$
9:00$PM$–$11:00$PM $
SHUTTLES$TO$NATIONAL$CONFERENCE$CENTER$(NCC )$
–!EVERY$30$MINS
DRIVEWAY$LOOP$ENTRANCE$
The!shuttle!service!is!for!guests!that!are!staying!at!the!NCC.
3
11
TH
$SEA-PHAGES$SYMPOSIUM$
Saturday,$June$8,$2019$
7:00$AM$–$8:15$AM$
BREAKFAST$
DINING $ROOM$
NCC!guests!will!be!shuttled!from!the!NCC!to!Jan elia !Re sea rch !Campus.!
8:30$AM$–$8:45$AM$
INTRODUCTORY$REMARKS$
STUDENTS$IN$AUDITORIUM$$
F
ACULTY$IN$SEMINAR$ROOM$
8:45$AM$–$10:15$AM$
ORAL$PRESENTATIONS$I$
M
ODERATOR:$SIMON $WHITE$
STUDENTS$IN$AUDITORIUM$$
F
ACULTY$IN$SEMINAR$ROOM$
ANNOTATION&OF&PHAGE&MCGALLEON&FROM&SUBCLUSTER&EA1&IN&MIC R O B A C T E R IU M&FOLIORUM&
E
LIZABETH$HAMPTON$&$DANIELLE$DAVIS$-$COLLIN$COLLEGE$
N
OVEL&BACTERIOPHAGES&AGAINST&ENVIRONMENTAL&PHACTORS&–&PHAGE&STABILITY&PUT&TO&THE&TEST!&
N
ICHOLAS$BARBIERI$&$ERIN$GALLAGHER$-$DREXEL$UNIVERSITY$
I
SOLATION&AND&CHARACTERIZATION&OF&MICROB A C T E R IU M&PHAGE&ETTA&AND&D IS C OVERY&OF&BACTERIOPHAGE&
&VERS&U SING &A&NOVEL&ANTARCTIC&CRYOBACTERIUM&ISOLATE&
K
ELSEY$LEACH$-$MINNESOTA$STATE$UNIVERSITY$MOORHEAD$
I
SOLATION&OF&MYCO BACTERIOP HAGES&FROM&SEW A GE&
E
MILEE$L$CARR$&$ROCHELLE$GAERTNER&-&BRIGHAM$YOUNG$UNIVERSITY$
A
&TALE&OF&DOGEMS&–&LESSONS&LEARNE D&OU T&OF&M.&FOLIORUM&PHAGE&HUNTING&
C
ASSANDRA$KELSO$&$NAOMI$SEMAAN&-&UNIVERSITY$OF$WEST$FLORIDA$
M
YCOBACTERIA&ACHIENSE&PHAGES:&CONTINUING&CHALLENGES&AND&UNSOLVED&PUZZLES&
T
AIANA$JAMES$& $SOLENE$SOSSAH$-&COLLEGE$OF$WILLIAM$&$MARY&
10:15$AM$–$10:30$AM$
BREAK$
LOBBY$
10:30$AM$–$12:30$PM$
POSTER$SESSION$I$
LOBBY$
12:30$PM$–$1:30$PM $
LUNCH$
DINING $ROOM$
4
11
TH
$SEA-PHAGES$SYMPOSIUM$
$
$
$
Saturday,$June$8,$2019$
$
$
1:30$PM$–$3:00$PM $
ORAL$PRESENTATIONS$II$
M
ODERATOR:$ELVIRA$EIVA ZOVA$
STUDENTS$IN$AUDITORIUM$
F
ACULTY$IN$SEMINAR$ROOM$
$
$
$
IDENTIFICATION&OF&TWO&GORDONIA&PHAGES:&STEAMEDHAM S&AND&SUERTE&
J
OHN$PERKINS$&$LAUREN$PINCUS$-$GEORGE$MASON$UNIVERSITY$
$
A
&NOVEL&APPROACH&TO&IMPROVING&AUTOMATED&BACTERIOPHAGE&GENOME&ANNOTATION&UTILIZING&M ACHINE&
LEARNING&
E
LISE$RASMUSSEN$-$JAMES$MADISON$UNIVERSITY$
$
E
XPLORING&A&SEA&OF&PHAGES:&NEW &INSIGHTS&INTO&PHAGE&GENOME&DIVERSITY,&HOST-PHAGE&INTERACTIONS,&AND&
IMMUNITY&RELATIONSHIPS&
C
AITLIN$MURPHY,$GRACE$CIABATTONI$-$LEHIGH$UNIVERSITY$
&
I
MMUNITY&TESTING&AS&A&PROBE&FOR&PHAGE&DIV ER S IT Y &PRIOR&TO&FULL-GENOME&SEQUENCING&
R
OSE$ALBERT$&$CARLY$SNIDOW&-&UNIVERSITY$OF$ALABAMA$AT$BIRM INGHAM&
&
L
YSOGENIC&HOST&BACTERIUM&ALT E R S&P L A T IN G&EFFICIENCY&OF&GORDONIA&BACTERIOPHAGE&
T
HOMAS$HARRINGTON$&$NOAH$THOMPSON$-$OUACHITA$BAPTIST$UNIVERSITY$
$
A
&STUDY&OF&PHAGE&WITH&ATTITUDES:&DEFENSIVE&GORDONIA&PHAGE&SIDIOUS&AND&MAGICMAN&AND&CRAZY&
RHODOCOCCUS&PHAGE&WHACK&AND&SLEEPYHEAD$
J
ESSICA$HAYDEN$&$ANDREW$FOURNIER$-&UNIVERSITY$OF$MAINE,$HONORS$C OLLEGE&
$
$
$
3:00$PM$–$3:15$PM $
BREAK$
LOBBY$
$
$
$
3:15$PM$–$5:15$PM $
POSTER$SESSION$II$|$EVEN-NUMBERED$POSTERS$
LOBBY$
$
$
$
5:15$PM$–$6:15$PM $
DINNER $
DINING $ROOM$
$
$
$
6:15$PM$–$6:30$PM $
GROUP$PHOTO$
FRONT$ENTRANCE$
$
$
$
6:45$PM$–$8:00$PM$
KEYNOTE$II$
Dr.$Graham$Hatfull$$
University$of$Pittsburgh$
STUDENTS$IN$AUDITORIUM$
F
ACULTY$IN$SEMINAR$ROOM$
$
$
$
8:00$PM$–$9:30$PM $
Social$
LOBBY$
$
$
$
9:00$PM$–$11:00$PM $
SHUTTLES$TO$NATIONAL$CONFERENCE$CENTER$(NCC)$
–!EVERY$30$MINS$
DRIVEWAY$LOOP$ENTRANCE$
The!shuttle!service!is!for!guests!that!are!staying!at!the!NCC.!
$ $
5
11
TH
$SEA-PHAGES$SYMPOSIUM$
$
$
Sunday,(June(9,(2019(
$
$
$
7:00$AM$–$7:30$AM$
CHECK-OUT$
$
NCC!guests!will!be!shuttled!from!the!NCC!to!Janelia.!All!guests!must!check !o ut!o f!th eir !roo ms!before!breakfast.!
Luggage!may!be!stored!in!the!Gallery!and!Synapse!Meeting!Room.!
$
$
$
7:00$AM$–$8:15$AM$
BREAKFAST$
DINING $ROOM$
$
$
$
8:30$AM$–$10:00$AM$
ORAL$PRESENTATIONS$III$
M
ODERATOR:$MATTHEW$MASTROPAOLO$
STUDENTS$IN$AUDITORIUM$$
F
ACULTY$IN$SEMINAR$ROOM$
$
$
$
IDENTIFICATION&AND&IMPLICATIONS&OF&SOIL-DWELLING&BACTERIAL&DNA&METHYLTRANSFERASE&HOMOLOGS&IN&
MYCOBACTER IUM&PHAGE&PHALM&
C
HRISTINA$SPENCER$&$KATELYN$GUTIERREZ$-$LETOURNEAU$UNIVERSITY$
$
C
HARACTERIZATION&OF&A&NEW&MICRO B A C T E R IU M&FOLIORUM&CLUSTER&EB&PHAGE&'STRO MBO LI':&A&TALE&OF&TOXINS,&
GIANT&LYSINS
,&HNH&ENDONUCLEASES,&AND&A&GENE&CLUSTER&PREDICTED&TO®ULATE&NUCLEOTIDE&LEVELS.&
S
TEPHANIE$PREISING$&$AMELIA$HOYT$-&SOUTHERN$CONNECTICUT$STATE$UNIVERSITY&
$
C
OMPARATIVE&GENOMIC&ANALYSIS&OF&31&SIPHOVIRIDA E &REVEALS&EXTENSIVE&HOST-DEPENDENT&RELATIONSHIPS&AND&
NOVEL&PHAGE&SUBCLUSTERS&
A
NDREW$KAPINOS$-$UNIVERSITY$OF$CALIFORNIA,$LOS$ANGELES$
&
C
OMPARATIVE&GENOMICS&OF&PHAGES&ISOLATED&ON&NEW&HOST&SPECIES&REVEALS&NOVEL&GENO M E&FEA TURE S&
K
AITLYN$FIELDS$&$SHAWNA$LARSON$-$UNIVERSITY$OF$WISCO N S IN -RIVER$FALLS&
&
N
ON-MYCO BACTERIAL&ACTINOBACTERIOPHAGES&PROVIDING&MORE&INSIGHT&TO&PHAGE&BIOLOGY&
A
NGELA$DE$JESUS$&$MARIANA$MORAES$-$ NYACK$COLLEGE$
$
F
UNCTIONAL&ANALYSIS&OF&CONSERVED&HYPOTHETICAL&GENES&IN&THE&CLUSTER&K&BACTERIOPHAGE&HAMMY&
S
AVANNAH$UNDERWOOD$-$UNIVERSITY$OF$SOUTHERN$MISSISSIPPI$
$
$
$
10:00$AM$–$10:30$AM$
BREAK$
LOBBY$
$
$
$
10:30$AM$–$11:45$AM$
KEYNOTE$III$
Dr.$Steffanie$Strathdee$$
University$of$California$San$Diego
$$
STUDENTS$IN$AUDITORIUM$$
F
ACULTY$IN$SEMINAR$ROOM$
$
$
$
11:45$AM$–$12:00$PM$
CLOSING$REM ARKS$
STUDENTS$IN$AUDITORIUM$$
F
ACULTY$IN$SEMINAR$ROOM$
$
$
$
12:00$PM$–$1:30$PM $
LUNCH$
DINING $ROOM$
$
$
$
12:00$PM$–$1:30$PM $
POSTER$REMOVAL$AND$DEPARTU RE$
LOBBY$
All!guests!will!be!shuttled!to!their!destination.!
$
6
!
11
th
!SEA!Symposium!
June!7!–!9,!2019!
!
GENERAL!INFORMATION!
!
PROGRAM!BOOK!&!AGENDA!ACCESS!
The!program!book!is!completely!online,!and!accessible!using!the!mobile!app!(recommended )!or!w eb !bro w ser. !
1. For!access!via!the!mobile!app,!!
• follow!the!instructions!provide d!in !the!e m ail!from ! CrowdCom pass,!
• if!you!have!not!rece iv ed !th e !email,!download!and!install!the!CrowdCompass!
AttendeeHub!app!from!the!App!Store!(iOS!devices)!or!Google!Play!Store!(android!
devices)!
• Once!installed,!search!for!“sea-phages”,!then!login!using!your!name!and!email!address.!
2. For!access!via!a!web!browser,!visit!https://event.crowdcompass.com/seasymp2019!and!login!using!your!name!and!
email!address.!
!
Note:!Hard!copies!of!the!program!book!and!agenda!will!NOT!be!available!at!the!symposium.!
A!downloadable/printable!agenda!(PDF)!is!also!available!at!the!program!website!at!https://seaphages.org/meetings/45/.!
!
STREAMING!
All!talks!in!the!Auditoriu m!will!be!streamed!live,!and!can!be!viewed!by!anyone!via!the!“LIVE!STREAM”!button!at!
www.seaphages.org.!Feel!free!to!encourage!your!friends!and!family!to!tune!in.!
!
PRESENTERS!&!MODERATORS!|!TALKS!
Those!selected!to!give!talks!must!upload!their!presentations!to!the!"SEA!Symposium!2019!Talks”!folder!in!Dropbox!by!
Thursday!June!6th,!2019.!Presen te rs!w ill!re ce ive !a!lin k !to!th is !Dr o pb o x !fold e r.!P lea se !na me!your!files!as!indica ted !in !th e!
document!“Symp_Filename”,!which!is!included!in!the!Dropbox!folder.!You!can!continue!to!update!your!talk!until!2!hours!prior!
to!your!talk,!wo rk ing!from!the!file!you!uploa d ed!to !Dro pb ox .!!
Slides!for!Session!Moderators!should!similarly!be!place!in!the!Dropbox!Folder,!using!the!filename!as!indicated.!
As!some!fraction!of!attendees!will!be!seated!in!an!overflow!room,!we!recommended!that!you!avoid!the!use!of!laser!pointers!
during!your!talk,!as!it!cannot!be!seen!in!the!overflow!room.!
!
PRESENTERS!|!POSTERS!
Every!school!is!required!to!present!one!student!poster!at!the!symposium.!The!maximum!height!and!width!for!each!poster!
cannot!exceed!48"x!48".!There!are!two!poster!sessions,!one!for!odd-numbered!posters!and!another!for!even-numbered!
posters.!Poster!assignments!can!be!found!in!the!program!book.!
7
!
MEETING!ROOMS!&!SEATING!ASSIGNMENTS!
All!talks!will!be!presented!in!the!Auditorium.!Talks!will!also!be!projected!in!the!Seminar!Room,!which!is!also!equipped!with!
microphones!and!video!capabilities!to!ask!questions!or!make!co m m en ts!du ring !the!talk s.!
!
• All!students!are!assigned!to!the!Auditorium!for!talks!througho ut!th e!symposium.!
• All!faculty!are!assigned!to!the!Seminar!Room!for!talks!throughout!the!symposium.!A!rotating!subset!of!faculty!will!be!
assigned!to!the!Auditorium.!Faculty!should!review!their!seating!assignments!on!their!name!badges!before!each!
session.!
!
ATTIRE!
Attire!for!the!entire!SEA!Symposium!is!business!casual.!
!
MEALS!
All!meals!will!be!provided!at!Janelia!Research!Campus.!Dining!tables!will!be!reserved!for!Cohort!12!faculty!and!P ha ge!
Discovery!Workshop!facilitators!for!lunch!on!Saturday.!
!
LODGING!INFORMATION!
Lodging!assignments!were!provided!to!participants!when!travel!plans!were!made.!Participants!will!be!lodged!at!one!of!the!
hotels!below:!
• Janelia!Research!Camp u s!(Jan elia)!–19700!Helix!Dr,!Ashburn,!VA,!20147!–!571-209- 4000!
• National!Conference!Center!(NCC)!–!18980!Upper!Belmont!Pl,!Leesburg,!VA!20176!–!703-724-5111!
!
TRAVEL!
• If!you!have!not! re ceiv ed!yo u r!travel!an d !hou sin g!co nfirm a tion s!from !H H M I!Trav el!Servic es,!y o u !will!need!to!
contact![email protected]!to!request!a!copy!of!you r!trave l!itinerary .!
• Before!travelling,!please!double-check!your!arrival!station/airport!and!the!shuttle!schedule.!Note!that!shuttle!service!
is!ONLY!p ro vid e d !fo r!arrivals!into!Dulles!Airport.!Throughou t!th e!meeting,!shuttle!servic e!w ill!b e !pro v id ed !b etween!
the!National!Conference!Center!and!the!Janelia!Research!Campus!(symposium !ve nu e) .!Guests!arriving!from!other!
locations !w ill!n ee d !to !ar ra ng e!for!their!own!ground!transportation!to!Janelia.!
!
SHUTTLE!BUS!SCHEDULE!
Shuttle!buses!will!be!provided!for!participants.!All!participants!are!required!to!use!the!shuttle!buses!during!their!published!
operating!hours.!The!shuttle!bus!schedule!can!be!found!in!the!online!program!boo k,!on line !at!
https://seap ha ges.o rg/m e eting s/45 /,!in!the!attach ed!download a b le / p r in ta ble!agenda!(P D F ),!an d !a t!t h e !e n d !o f !th i s!message.!
!
PARKING!
Parking!at!Janelia!Research!Campus!is!available!ONLY!for!overnight!guests !stayin g!at!Jan elia,!an d !for!da y!gu ests.!O ve rnigh t!
guests!staying!at!the!National!Conference!Center!must!leave!their!cars!at!the!hotel!and!use!the!shuttle!busses!provided!from!
the!hotel!to!Janelia.!
!
REIMBURSEMENT!OF!EXPENSES!
Participants!are!expected!to!cover!the!cost!of!incidentals!(e.g.!meals!during!travel,!baggage!fees,!or!lodging!not!required!for!
the!meeting).!HH M I!w ill!NO T!reim b urse !you !for!trav el!insu ran ce,!pers on al!ch arge s!such !as!entertainment,!or!taxis!to!tour!D.C.!
or!visit!friends.!
If!you!belie v e!s p e cia l!cir cu mstances!justify!r eimbursemen t,!p le as e !co n ta c t!B illy !B ied e rman!at!sea@hhm i.org.!In!s u ch !c as e s,!it !
is!importa n t!th a t!yo u !ke e p !all! rec eipts!a nd !trave l!stubs .!
!
HASHTAG!
#seasymp2 019!
8
11
th
!SEA!Symposium!
SYMPOSIUM!&!HOTEL!LOCATIONS!
SYMPOSIUM!
HHMI!Janelia!Research!Campus!
19700!Helix!Drive!
Ashburn,!VA!20147!
Google!Map:!https://goo.gl/maps/aQ85zWqKUYWoQ9tx8!
Tel.!571-209-4000!
http://www.hhmi.org/janelia!
HOTEL!LOCATIONS!
Janelia!Research!Campus!(Janelia)!
19700!Helix!Dr,!!
Ashburn,!VA,!20147!
Google!Map:!https://goo.gl/maps/aQ85zWqKUYWoQ9tx8!
Tel.!571-209-4000!
National!Conference!Center!(NCC)!
18980!Upper!Belmont!Pl,!!
Leesburg,!VA!20176!
Google!Map:!https://goo.gl/maps/fJaBYFupxSDHgiqo8!
Tel.!703-724-5111!
9
11
th
SEASymposium
SHUTTLEINFORMATION
RestonLimousinewilloperateshuttlebusesbetweenDullesAirport,Janelia,andtheNational
ConferenceCenterfollowingtheschedulebelow.
GuestsarrivingatDullesAirportproceedtoBaggageClaimArea,Carousel#3.ARestonLimousine
representativewillbeholdingasignforHHMIandwilldirectgueststobusesgoingtoJaneliaorthe
NationalConferenceCenter.
ARRIVALS–Friday,June7,2019
SHUTTLES–DullestoJaneliaandDullestoNationalConferenceCenter*
Departat:
12:00PM
1:15PM
2:30PM
SHUTTLES–DullestoJaneliaonly
Departat:
3:45PM
4:15PM
5:00PM
* Guestsarrivingattheairportafterthedepartureofthe2:30PMshuttleshouldshuttledirectlytoJanelia.
NationalConferenceCenterguestscanstoreluggageatJaneliaandbringitontheshuttletotheNational
ConferenceCenteraftertheeveningsocialactivities.)
SHUTTLES–NationalConferenceCentertoJanelia
Departat:
1:30PM
2:30PM
3:30PM
4:30PM
GuestsstayingattheNationalConferenceCentercanalsousethenon‐HHMINationalConference
CentershuttlefromDullestotheNationalConferenceCenter.
EVENINGS–FridayandSaturday
SHUTTLES–JaneliatoNationalConferenceCenter
Departat:
9:00PM
9:30PM
10:00PM
10:30PM
11:00PM
MORNINGS–SaturdayandSunday
SHUTTLES–NationalConferenceCentertoJanelia
Departat:
6:45AM
7:15AM
7:45AM
8:10AM
DEPARTURES–Sunday,June9,2019
SHUTTLE–JaneliatoDullesandJaneliatoReaganNationalAirport(DCA)**
Departat1:00PM
SHUTTLE–FromJaneliatoHHMIHQ(forSEABioinformaticsMeetingGuestsOnly).
Departat2:00PM
**Additionaltransportationinformationwillbepostedonthedeparturelistattheregistrationdesk.
10
SEA Institution
Poster #
Baylor University
Poster #049
Bowling Green State University
Poster #076
Brigham Young University
Poster #110
Cabrini University
Poster #122
Calvin College
Poster #005
Carthage College
Poster #117
Coastal Carolina University
Poster #010
College of Idaho
Poster #053
College of Southern Nevada
Poster #025
College of St. Scholastica
Poster #034
College of William & Mary
Poster #077
Collin College
Poster #009
Columbia State Community College
Poster #101
Culver-Stockton College
Poster #102
Del Mar College
Poster #011
Doane University
Poster #037
Dominican College of Blauvelt
Poster #061
Drexel University
Poster #062
Durham Technical Community College
Poster #051
Fayetteville State University
Poster #050
Florida International University
Poster #017
George Mason University
Poster #115
Gonzaga University
Poster #028
Hampden-Sydney College
Poster #016
Hillsborough Community College
Poster #029
Hope College-Joe Stukey
Poster #035
Hope College-Matthew Gross
Poster #086
Howard Hughes Medical Institute
Poster #045
Howard University
Poster #096
Illinois Wesleyan University
Poster #015
Indian River State College
Poster #112
Indiana University of Pennsylvania
Poster #087
Iowa State University
Poster #064
James Madison University-Tiyam Assadapour
Poster #023
James Madison University-Elise M Rasmussen
Poster #085
James Madison University-Louise Temple
Poster #123
Johns Hopkins University
Poster #075
Kansas State University
Poster #042
La Salle University
Poster #091
La Sierra University
Poster #116
Lafayette College
Poster #109
Lehigh University
Poster #030
LeTourneau University
Poster #002
Massey University
Poster #074
Merrimack College
Poster #033
Miami University
Poster #107
Minnesota State University Moorhead
Poster #097
Mitchell Community College
Poster #007
Monmouth College
Poster #068
Montana Tech of the University of Montana
Poster #078
Montclair State University
Poster #089
Morehouse College
Poster #066
Mount Saint Mary College
Poster #114
11
Nebraska Wesleyan University
Poster #013
Neumann University
Poster #012
North Carolina A&T State University
Poster #014
Northern State University
Poster #027
Northwest Indian College
Poster #111
Northwestern College
Poster #054
Nyack College
Poster #090
Ouachita Baptist University
Poster #058
Providence College
Poster #070
Purdue University
Poster #120
Queens University of Charlotte
Poster #080
Queensborough Community College
Poster #065
Radford University
Poster #072
Rockland Community College
Poster #057
Saint Joseph's University
Poster #113
Saint Leo University
Poster #079
Salem State University
Poster #105
Southern Connecticut State University
Poster #038
Southern Maine Community College
Poster #044
SUNY Old Westbury
Poster #063
Tarleton State University
Poster #019
The Evergreen State College
Poster #043
The Ohio State University
Poster #046
Truckee Meadows Community College
Poster #082
Universidad Autónoma de Nuevo León
Poster #073
University of Alabama at Birmingham
Poster #055
University of California, Los Angeles
Poster #099
University of California, San Diego
Poster #118
University of Central Oklahoma
Poster #100
University of Colorado at Boulder
Poster #098
University of Connecticut
Poster #081
University of Detroit Mercy
Poster #092
University of Evansville
Poster #032
University of Hawaii at Manoa
Poster #108
University of Ibadan
Poster #024
University of Kansas
Poster #026
University of Lagos
Poster #041
University of Louisiana at Monroe
Poster #022
University of Maine, Farmington
Poster #039
University of Maine, Honors College
Poster #067
University of Mary
Poster #047
University of Mary Washington
Poster #071
University of Maryland, Baltimore County
Poster #094
University of Nebraska-Lincoln
Poster #104
University of Nevada Las Vegas
Poster #048
University of North Georgia
Poster #004
University of North Texas
Poster #059
University of Pittsburgh
Poster #121
University of Puerto Rico at Cayey
Poster #106
University of South Florida-Richard Pollenz
Poster #020
University of South Florida-Louis Otero
Poster #084
University of Southern Mississippi
Poster #093
University of Texas at El Paso
Poster #001
University of the Ozarks
Poster #103
12
University of the Sciences in Philadelphia
Poster #006
University of West Alabama
Poster #069
University of West Florida
Poster #031
University of Wisconsin-River Falls
Poster #040
Virginia Commonwealth University
Poster #003
Virginia State University
Poster #052
Virginia Tech-Stephanie Voshell
Poster #088
Virginia Tech- Elizabeth Burrell
Poster #095
Virginia Western Community College
Poster #021
Washington University in St. Louis- Nitan Shalon
Poster #018
Washington University in St. Louis- Christopher D Shaffer
Poster #060
Western Carolina University
Poster #119
Western Kentucky University
Poster #083
Winthrop University
Poster #008
Worcester Polytechnic Institute
Poster #036
Xavier University of Louisiana
Poster #056
13
11th Annual SEA Symposium Abstract
Baylor University
Waco TX
Corresponding Faculty Member: Tammy Adair ([email protected])
Gabriel Andino
Discovering genetic diversity with NapoleonB
Gabriel Andino, Kathryn Adkins, Sriram Avirneni, Emily Balint, Henry Burns, Lucy Fisher, Lauren Foley, Emily
Gaw, Lily Goodman, Soo-Un Jeong, Cooper Johnson, Melissa Leon Norena, Michael Lum, Rachel Melone,
Nathan Newton, Aman Patel, Sabin Patel, Lucy Potts, Brandon Reider, Shepard Saaybe, Sona Subramanian,
Joseph Yu, Justin Yu, Lathan Lucas, Leo Rule, Aadil Sheikh
Arthrobacter, a type of bacteria commonly found in soil and sewage, has recently been used as a host for
phage isolation by the SEA-PHAGES program. For this project, Arthrobacter sp. ATCC KY3901 was used to
isolate Arthrobacter phage NapoleonB. This phage was used to explore genetic diversity of AM phages.
NapoleonB was isolated using enriched media, and a DNA sample was sequenced by the Pittsburgh
Bacteriophage Institute using Illumina sequencing. Genome, annotations were manually curated using tools
such as DNA Master, NCBI databases, PhagesDB, HHpred, and Phamerator. After isolation and genome
annotation, several questions regarding the uniqueness of NapoleonB and AM phages were raised in the form
of %GC content, protein structure and mechanisms, unique repeats, and the potential for super-clustering. To
test these questions and further explore NapoleonB’s genome, multiple sequence alignments were performed,
phamerator maps were analyzed to determine any patterns in synteny, and NapoleonB’s holin and endolysin
proteins were characterized through tertiary structure predicting computer programs such as Jmol and
RaptorX. NapoleonB exhibits siphoviridae morphology and produces two distinct sizes of clear plaques with
average diameters of 1.5 mm or 0.1 mm. Bioinformatic annotations indicated 100 potential genes, 73 with no
known function and 25 with predicted functions within the 57,846 base pair genome. NapoleonB and other
AM phages differ from other Arthrobacter phage clusters with significantly lower %GC. It was also noted that
all phages in the cluster AM contain a putative holin protein that has previously been annotated as having no
known function. Further examination of Arthrobacter phage lysin cassettes identified different types of
conserved catalytic regions. This information provides examples of what makes NapoleonB and other AM
phages unique among other clusters; it helps expand previous knowledge about phage diversity. Future
bioinformatic work can address variations in %GC and potential super-clusters using models of horizontal gene
transfer and comparative genomics.
14
11th Annual SEA Symposium Abstract
Bowling Green State University
Bowling Green OH
Corresponding Faculty Member: Jill Zeilstra ([email protected])
Linnéa Forbes
The Bowling Green State University Expanding Mosaic of Mycobacterium
Bacteriophage
Linnéa Forbes, Rachel Bowling, Benjamin Caskey, Colton Flaherty, Chloe Koon, Edward Madden, Morgan
Nance, Lauren Tucker, Ashley Wong, Sayantan R Choudhury, Raymond Larsen, Vipaporn Phuntumart, Zhaohui
Xu, Jill Zeilstra-Ryalls
During the fall semester of the 2018-2019 Bowling Green State University SEA-PHAGES Program, 17
bacteriophage were isolated. Among these, one was individually sequenced while DNA from 12 others were
combined and sequenced en masse. The sequencing results revealed that the individually sequenced lytic
Siphoviridae phage JoieB belongs to the S cluster. This phage was annotated during the spring semester, and a
number of characteristics of the genes present in the phage were investigated. The en masse sequencing
results for the 12 additional phage revealed that clusters A1, A4, B1, C1, G1, J, and S are represented among
them. We were able to determine that the S cluster phage is Pringar. Interestingly, plaque size varied
significantly between the two S cluster phage; JoieB formed plaques that were approximately 1 mm in
diameter while those of Pringar resembled pinpricks that were too small to measure. Other relationships
between the genomes of Joieb and Pringar are discussed. Bowling Green State University has now isolated 41
new bacteriophages, and sequence results to date reveal that they include representatives of the rare S and W
clusters.
15
11th Annual SEA Symposium Abstract
Brigham Young University
Provo UT
Corresponding Faculty Member: Julianne Grose (julianne_grose@byu.edu)
Emilee L Ca
rr
Rochelle Gaertner
Isolation of Mycobacteriophages from Sewage
Emilee L Carr, Elise Melhado, Emily Loerscher, Trever Thurgood, Ruchira Sharma, Donald P Breakwell,
Rochelle Gaertner, Julianne H Grose
Each year there are 2 million reported antibiotic resistant infections and millions more that go on unreported
in less developed countries. Alternatives to antibiotics that still effectively lyse and kill bacteria are being
researched with the forerunner being bacteriophage therapy. The HHMI SEA Phages program has isolated
thousands of phages that infect Mycobacterium smegmatis, which can cause edema, redness, and pain in
infected soft tissue. In the lab of Doctor Julianne H Grose, we attempted to isolate bacteriophages against
Mycobacterium smegmatis that are more clinically relevant by using sewage as the isolation source. To
characterize these phages, they were isolated from primary effluent from sewage plants, sequenced through
high throughput sequencing, and annotated using both the automated system DNA Master and by analyzing
coding potential. Ultimately, these phages will fall into phage families whose relativity is based on highly
conserved proteins. These proteins may reveal unique characteristics in the phages that allow them to be
more or less useful in phage therapy. The M. smegmatis phages did fall into pre existing families and the next
step is to look at the proteins that are different between the families and the implications thereof. This
research will add to the growing understanding of phages which allow the phages to be more fully
characterized and therefore, more likely to be used in phage therapy.
16
11th Annual SEA Symposium Abstract
Cabrini University
Radnor PA
Corresponding Faculty Member: Vinayak Mathur ([email protected])
Rya Scull
Discovery and Annotation of Cluster AN and AK Arthrobacter Phages
Rya Scull, Jessica Azzarano, Jordan Abelson, Jessica Baranoski, Lavinia Harrison, Megan M Wojcik, Sonia
Spadafora, Kyriaki Gerasimidis, Olivia Mancini, Epoh Fonge, Isabella Romani, Alyson Marshall, Andrew Conboy,
Matthew D Mastropaolo*, Vinayak Mathur, Melinda Harrison
* Neumann University, Aston PA
Bacteriophages are viruses that infect a bacteria host, potentially leading to strategies for treating, preventing,
or diagnosing bacterial infections such as tuberculosis that are resistant to conventional antibiotics. We have
discovered novel phages from the bacterial host Arthrobacter sp.ATCC 21022. The phages were collected from
soil and water samples by students from various places around South Eastern PA. and Southern NJ. and their
genomic DNA isolated. After isolating the genomic DNA, they were photographed through the use of an
electron microscope and then the DNA was sequenced. The phages’ genomes were then annotated using
various bioinformatics tools, such as DNA Master; Phamerator; HHpred and GeneMark to determine gene
location and function. Using comparative genomics, unique characteristics of the phage’s genome were also
explored. This study presents a comparison of several bacteriophage genomes specifically from the AN and AK
cluster. The genomes of phages Arby and Scuttle were annotated as a collaborative effort by many students
and faculty.
17
11th Annual SEA Symposium Abstract
Calvin College
Grand Rapids MI
Corresponding Faculty Member: John Wertz ([email protected])
Emily A Sall
The Puritan and the Phloozy: Genomic insights into the lifestyles of
Gordonia phages Jabberwocky and Schwartz33
Noah P Ambrose, Elizabeth C Bolton, Samuel L Braak, Erin S Brink, Anna L Christiansen, Sarah G Gibes, Liam P
Hoogewerf, Fanny J Johns, Leah H Knoor, Katherine M Koning, Stephanie L Robinson, Christina D Romano,
Emily A Sall, Emily G Schellenboom, Lauren M Steffen, William M Terpstra, Nathan J Wilkes, Mary Rose
Horner-Richardson, Randall J DeJong, John T Wertz
Six Gordonia phages with siphoviridae morphology were isolated from soils in Grand Rapids, Michigan, using
Gordonia terrae 3612 as a host. Three were isolated via direct plating and three via enrichment. We obtained
complete genome sequences from two, Jabberwocky (enrichment; 85 ORF’s; subcluster DE1) and Schwartz33
(direct; 89 ORF’s; cluster DJ). Jabberwocky is most closely related to Stultis (93.2% nucleotide identity) and
Schwartz33 is most closely related to OhMyWard (68.4% nucleotide identity). Jabberwocky’s genome
contained all of the expected ORF’s, but the genome of Schwartz33 was missing several, including tail
assembly chaperones and scaffolding proteins. The genome of Schwartz33 also contained nineteen orphams,
significantly more than others in this cluster (OhMyWard has
six orphams). Several of the orphams were found to have a function, including a capsid maturation protease, a
deoxycytidylate deaminase, a ThyX thymidylate synthase, a DNA helicase, and two membrane proteins. This is
the second year in a row our phages grouped within DE1 and DJ, so we compared Jabberwocky and
Schwartz33 with our previously isolated phages Kroos and Tanis. Jabberwocky and Kroos have moderate
synteny but are only 76.3% identical at the nucleotide level. Schwartz33 and Tanis also have moderate synteny
but are only 62.4% identical at the nucleotide level. We also used information on phamdb.org to explore
possible correlations of clusters DE1 and DJ with geographic location, soil type, and isolation date. No
significant correlations were found. Jabberwocky had 37 phams unique to the DE1 subcluster. Of the
remaining, most were clusters exclusive to Gordonia phages. This suggests that Jabberwocky’s genome has
evolved from phages with a limited host range. In contrast, Schwartz33 contains 30 phams found exclusively in
the DJ cluster, but only six phams were found solely in Gordonia phages. 30 phams were also found within the
two Rhodococcus phages in cluster CC: Pepy6 and Poco6, 14 of which were found within the first ⅓ of the
genome and are structural in nature. Schwartz33 also shared 20 phams with the BI cluster (Streptomyces); 21
phams with Arthobacter clusters AM, AU and AW; 18 with EL (Microbacterium); and at least one ORF within
18
Mycobacterium clusters K, L and M. Of the phams found in multiple bacterial genera, 16 had AM, AU, AW, BI,
CC and EL together in a single pham. This leads us to believe the evolutionary history of Schwartz33 draws on
phages with a broad host range. The fact that Schwartz33 shared 30 phams with Rhodococcus phages, many
identified as having a structural function, makes testing of DJ phages on a Rhodococcus host enticing.
19
11th Annual SEA Symposium Abstract
Carthage College
Kenosha WI
Corresponding Faculty Member: Deb Tobiason ([email protected])
Mason Fanelle
Discovery and Analysis of Mashley (Cluster EG), Den3 (Cluster EA1) and
Velene (Cluster EA1)
Mason Fanelle, Asher Boucher, Ashlynne Edwards, Cristian Hilliard, Letitia Siers, Krysti Vanovenoeke, Andrew
Albers, Amy Cooper, Gelene Rivera, Victor Austin, Madeline Perez, Steven Henle, Qinzi Ji, Sheryl Konrad,
Deborah Tobiason
During the Fall semester at Carthage College, 58 bacteriophages were isolated using Microbacterium foliorum
as a host. These phages were purified and characterized, and three of the phages were chosen for DNA
sequencing and annotation (Den3, Velene and Mashley). All three annotated phages are lytic and lack an
integrase gene. In addition, these phages have siphoviridae morphology with long, flexible, non-contractile
tails. After sequencing and annotation, Den3 and Velene were found to belong to cluster EA1 and are very
similar to each other. Mashley belongs to cluster EG and has several orphams. Mashley is most closely related
to phage Hyperion though the EG cluster is quite diverse, and Mashley appears to contain unique sections.
Further analysis of these phages spans topics from doing whole genome comparisons to focusing on specific
genes of interest to determine phylogeny and analyzing regions of interest such as repeated DNA sequences.
There is relatively little data available thus far on Microbacterium phages; therefore, our research will boost
our understanding of Microbacterium phages, especially those in clusters EA1 and EG.
20
11th Annual SEA Symposium Abstract
Coastal Carolina University
Conway SC
Corresponding Faculty Member: Daniel Williams ([email protected])
Tyler Cutaia
Isolation and Annotation of Gordonia Bacteriophages Mayweather and
Kenosha
Tyler Cutaia, BIOL 492 Students, Daniel C Williams
With the goal of exploring bacteriophage diversity, Phage Discovery students at Coastal Carolina University
discovered 7 new phages in the fall semester of 2018. The phages, which infect the host bacterium Gordonia
rubripertincta, were isolated using enriched isolation techniques. Two of these phages, Mayweather and
Kenosha, were sequenced and annotated the following semester. Both phages had plaques of various
morphologies, but Mayweather’s plaques were very clear, suggesting that this is a virulent phage. Mayweather
is a CT cluster phage with a 48,382 bp genome and GC content of 60.6%. We verified 75 predicted genes and
assigned functions such as terminase and minor tail proteins to 25. There was little support for functions of the
remaining 50 genes and interestingly 9 of them are orphams. In contrast, Kenosha is a DJ cluster phage with a
longer genome of 60,899 bp and has a GC content of 51.8%. This phage has 92 predicted genes, 8 of which are
orphams. We assigned functions to 20 genes that code for common gene products such as HNH endonuclease,
lysin A, and holin. Future research from Coastal students will involve working as part of the SEA-GENES project,
where wet bench experiments will be performed to assess whether predicted genes have cytotoxic effects on
bacterial host cells.
21
11th Annual SEA Symposium Abstract
College of Idaho
Caldwell ID
Corresponding Faculty Member: Ann Koga ([email protected])
Kaiden Lee
Beauty and the Beast: Characterizing Axym and Untangling Jumble
Kaiden Lee, Megan Rockefeller, Ann P Koga
In the fall semester, our BIO 210 lab isolated several phages from soil on our campus using Gordonia terrae as
a host. We sent two samples to University of Pittsburgh for sequencing. In the spring semester we annotated
the genome of Axym, which belongs to Cluster CT. Like other CT cluster phages, Axym appears to have a lytic
life cycle, no tRNA genes, and a split Lysin A gene found on the far-left end of the genome. As we were
annotating Axym, we noticed a high level of similarity to a subset of CT phages and very little similarity to other
CT phages. Thus, we compared the CT phages using the Gene Content Comparison tool available on Phagesdb
and by SplitsTree4 analysis (Huson, 2006). From these data, we propose that Axym, along with five other CT
phages, should be placed in a new subcluster within the CT cluster. Our second sample, aptly named Jumble,
contained a mixture of 2 genomes: one from the DG cluster (Jumble_DG) and one from the CQ cluster
(Jumble_CQ). In order to annotate these two genomes, we first needed to separate and purify them for
archiving and determine which phage went with which genome sequence. We designed primers for each
phage based on unique sequences in their tape measure genes, determined optimal PCR conditions and
repeated plaque purification several times in order to get pure cultures. We created lysates, then used the
primer sets to test for the presence of each genome in the purified lysates. We also re-examined the electron
microscopy images and found phages with two different tail lengths. Using tape measure gene length, we were
able to match each EM image to the correct phage and genome.
D. H. Huson and D. Bryant, Application of Phylogenetic Networks in Evolutionary Studies, Mol. Biol. Evol.,
23(2):254-267, 2006.
22
11th Annual SEA Symposium Abstract
College of Southern Nevada
Las Vegas NV
Corresponding Faculty Member: James Theoret ([email protected])
D'Andrew L Harrigton
The College of Southern Nevada’s Exploration and Annotation into the DR
and CS Clusters throughout the Las Vegas Valley
D'Andrew L Harrigton
Throughout the 2018-2019 Fall and Spring semesters, the College of Southern Nevada’s SEA-PHAGES team
studied methods of articulation with biological and computational sciences regarding the extraction,
annotation, and experimentation of novel Gordonia-phages Jellybones and Nhagos. Both phages were
discovered within the Las Vegas valley and were identified using the host bacterium Gordonia rubripertincta.
While sharing the same morphotype, siphoviridae, both phages provided unique overall results. Jellybones
exhibited optimal temperatures differing from Nevada’s average soil temperatures.
Jellybones, a CS2 subcluster Gordonia-phage, was discovered within the City of Henderson’s Bird Viewing
Preserve. Producing plaques ranging from ½ - 1mm, Jellybones has a genomic length of 77,514 base pairs
covering 108 encoded genes; 1 transfer RNA was detected with an anti-codon of GTT (Asparagine). A GC
percentage of 59.0% was above the 58.9% average for this subcluster. 32.0% of Jellybones was annotated
without a classification of NKF. Annotations of Gordonia-phage Jellybones was completed with; DNA Master,
GeneMark, HHpred, Blast, Starterator, Phamerator, SOSUI, and TMHMM. Experimentation of Jellybones was
conducted to determine calcium dependency and temperature ranges for optimal lytic cycles. Results of our
temperature assay shows an optimal temperature for the lytic cycle at 20 °C. Results of our calcium assay show
plaque growth in the presence of calcium through a lytic cycle. These results can be used for future
investigation of Gordonia-phages by the College of Southern Nevada’s cohort.
NHagos, a DR cluster Gordonia-phage, was discovered within a flamingo exhibit. Producing small, clear and
round plaques, Nhagos is a circularly permuted genome sequence with a genomic length of 59,580 base pairs
covering 83 encoded genes; no tRNA was detected. A GC of 68.2%, was lower than the 69.2% average for the
DR cluster. Annotation and review through Gepard indicate a similar mosaic structure to that of the B
(Mycobacterium) and W (Mycobacterium) clusters. We replicated these findings by providing three separate
phages from each cluster; The W cluster consisted of Mycobacterium-phages Cepens, GodPhather, and
Megabear, while, The B cluster consisted of Mycobacterium-phages Cheet0, Apex, and Abinghost. These
23
similarities are measurable within Phamerator throughout each cluster, indicating levels of homology within
each cluster. This method of determining homology could, in theory, reduce the amount of NKF proteins found
relating to morphotype. The College of Southern Nevada is proud to share its first findings for the SEA-PHAGES
symposium and how temperature, calcium, and mosaic patterns could be found in a sea of collaboration.
24
11th Annual SEA Symposium Abstract
College of St. Scholastica
Duluth MN
Corresponding Faculty Member: Daniel Westholm ([email protected])
Phylogenetic and genomic characterization of Actinobacteriophages
NadineRae and PetterN
Ryan J Steger, Lauren E Buchholz, Breanna D Cole, Kelsey K Fletcher, Ashlie K Johnson, Robin N Kutsi, Chloe S
Larson, Nathan A Schacht, Anna C Totsch, Daniel E Westholm
Actinobacteriophages NadineRae and PetterN were isolated on Gordonia terrae and Mycobacterium
smegmatis, respectively, as part of the SEA-PHAGES program at The College of Saint Scholastica. Genomic
sequencing of NadineRae revealed a 64,714 bp genome with 66.1% GC content and subcluster CR4
designation. MEGA Phylogenetic analysis indicated Gordonia phage Marietta, isolated in 2017 by a St.
Scholastica student, was among the closest relatives to NadineRae. Expanded phylogenetic comparisons with
both Gordonia phages and Gordonia bacterial species did not present a clear relationship between Gordonia
phage genomes and the particular Gordonia species with which they were isolated. Phamerator comparisons
with close CR4 relatives indicated several areas of sequence repeats on the right arm of the genome between
coordinates 57,000-63,000. When NadineRae’s genome was BLASTed against itself, three distinct sequence
repeats were mapped to this region. Within these coordinates, the first repeat with consensus sequence
GTAGGGCCCGGCGAGATCTCGCGCCGGGCCCTAC appeared 12 times, the second with consensus sequence
GTAGCTCACCCCGTAGGGCCCGGCGAGATCTCGCGC appeared 12 times, and the third with consensus sequence
GACGCGCAGCGCGCTGCG---GCCGACGCGGCC appeared 10 times. All three of these repeats appeared
elsewhere in the genome, but at lower frequency. The precise function of these repeats was not fully
elucidated, but the DNA motif prediction software TomTom identified possible repressor or activator binding
activity. In addition, NadineRae protein expression patterns were examined using tandem mass spectrometry.
Liquid infections of NadineRae were performed for 4 hours, pelleted and subjected to LC-MS/MS to identify
expressed phage proteins. Data is not yet available, but hopefully will be by the symposium. Finally, the
lysogeny related genomic sequences of the temperate Mycobacteriophage PetterN were examined. Using the
DNA Scan feature in DNA Master 19 stoperator sequences were identified with consensus sequence
GTACGATGTCAAG. Most of the genes where these stoperator sequences occurred had no known function, but
several played structural or assembly roles.
25
11th Annual SEA Symposium Abstract
College of William & Mary
Williamsburg VA
Corresponding Faculty Member: Margaret Saha (mss[email protected])
Taiana J James
Solene M Sossah
Mycobacteria achiense Phages: Continuing Challenges and Unsolved
Puzzles
Taiana J James, Gokul Achayaraj, Oluwatobi W Adepoju, Emin Ahsan, Phillip A Andoh, Hallie F Avalos, Sanjana
Challa, Kiara C Douglas, Madison P Foster, Ingrid V Guardado-Cruz, Nicole A Harris, Thomas M Hess, Joshua R
Hughes, Soledad V Jimenez, Jerry S Sanchez-Lopez, Daiwik P Munjwani, Elias H Nafziger, Bisola N Olowe, Helen
S Owusu, Veda S Pai, Ray Q Smith, Solene M Sossah, Angelique T Vo, Yessica A Bonilla, Elizabeth N Do,
Alexandra A Huang-Queiroz, Autumn Liu, Camille C Okonkwo, Sudip Paudel, Mark H Forsyth, Margaret S Saha
In an attempt to expand the diversity of phages that infect hosts within the Mycobacterium genus, 22
freshmen who comprised the William and Mary 2018-19 SEAPHAGES Lab attempted to identify phages that
infected Mycobacterium achiense. We selected this host because we wished to investigate host range in
Mycobacterial species other than M. smegmatis given the clinical importance of the genus and also because
there are currently no reports of phage isolated from M. achiense. Moreover in the past year, high school
students from Jamestown, Virginia participating in phage outreach events at William and Mary, isolated over
50 phages from this host. However after eight weeks and several hundred enrichment attempts in the 2018-
2019 SEAPHAGES program, only a single phage was isolated – HerbertWM. Working with HerbertWM
presented challenges and puzzles at every step of the process. The phage consistently had extremely low titers
that declined quickly over time. DNA isolation was equally challenging. Following optimization of DNA
extraction methods, PEG precipitation of large volume liquid cultures produced a sufficient amount of DNA for
sequencing. Sequencing resulted in a 51 kb phage that may represent a new subcluster within the A cluster.
Surprisingly, there was also a 11 kb “phagelet” that shared little identity with the 51 kb HerbertWM, but did
encode a terminase, a tape measure protein, and several structural proteins. A current hypothesis proposes
that this 11 kb fragment may represent a satellite phage; all phages isolated from this species appear to have
26
the 11 kb fragment based on gel analysis. Sequencing of the host and other M. achiense phages is underway to
resolve the ongoing puzzle of the unique bacteriophages isolated from this host.
27
11thAnnualSEASymposiumAbstract
CollinCollege
PlanoTX
CorrespondingFacultyMember:BridgetteKirkpatrick(bkirkpatr[email protected])
ElizabethSHampton
DanielleJDavis
AnnotationofPhageMcGalleonfromSubclusterEA1inMicrobacterium
foliorum
ElizabethSHampton,DanielleJDavis,Thanh‐HuyNguyen,KirkSNiekamp,KaitlynMRiley,CaroleM
Twichell,JonathanNLawson,BridgetteLKirkpatrick
ThisprojecthighlightsthegenomeannotationofthesiphoviridaebacteriophageMcGalleon(MG).McGalleon
isalyticphageisolatedusingMicrobacteriumfoliorum,andisamemberofclusterEA,subclusterEA1.
McGalleonhasagenomelengthof42,562bp,anda63.70%,currentlythelongestgenomeoftheEAcluster
andthehighestGC%ofthesubcluster.AnnotationutilizedthebioinformaticstoolsDNAMaster,Glimmer,
Genemark,PhagesDBBLAST,NCBIBLAST,HHPred,andPhamerator.Ofthe65genesidentifiedthroughauto‐
annotation,threegenesweredeletedduetolackofcodingpotential.Analysissupportedassigningfunctions
to26ofthe62annotatedgenes,andtwopreviouslyunidentifiedregionswerediscoveredduringmanual
annotation:MG_2andMG_52.MG_2isaninsertionnearthebeginningofthegenome.MG_52islocated
wheretwogeneswerepredictedtobe,basedontheirpresenceinmostphageinthesubcluster.However,
MG_52lackssimilaritytoeitherofthemissinggenesnormallyfoundintheregionsurroundingMG_52.
McGalleonismissingagenepredictedtohavephosphoesteraseactivity,whichisfoundin51of64phagefrom
EA1.
28
11th Annual SEA Symposium Abstract
Columbia State Community College
Columbia TN
Corresponding Faculty Member: Elvira Eivazova ([email protected])
Gregory Markov
Isolation, characterization and annotation of bacteriophages using the
soil-dwelling host Microbacterium foliorum.
Gregory Markov, Ximena Leon, Megan Mohundro, Jenna St. Pierre, Carter Woehlert, Tessa Cote, Tristan
Watson
Bacteriophages, viruses that specifically infect bacteria, are the most abundant organisms on the planet.
Phages have been of interest to scientists because they can efficiently destroy bacteria, and therefore, can be
used for phage therapy. We isolated and characterized bacteriophages using a known host, the soil-dwelling
bacterium Microbacterium foliorum. Bacteriophages were purified and amplified to increase the concentration
of phage particles. The isolated bacteriophage genomic DNA was purified, treated with restriction enzymes
and characterized using gel electrophoresis. The viral samples were visualized using transmission electron
microscopy. We observed various viral life cycles: the lytic life cycle, where phages infect and rapidly kill
infected host cells, as well as the lysogenic life cycle, where phages integrate into the host genome, instead of
directly killing the host. The purified phage DNA samples were sequenced at Pittsburgh Bacteriophage
Institute, and the novel sequences were annotated at CSCC. Phages Manatee and Vanisius are members of the
Siphoviridae family. Manatee is a temperate phage belonging to the A cluster, A1 subcluster. Vanisius is a lytic
phage belonging to the EE cluster. The genomes are considerably different in size with no gene sequence
similarity. The genomes were analyzed based on their start and stop codons, z-scores, identity matches, cross-
references in Phamerator, and between NCBI and HHPred toolkits.
Our future goal is to further explore phage genome communities isolated from the immediate environment.
Evaluating and understanding phage biology and taxonomy is essential to the development of phage therapy
approaches and biotechnology application.
29
11th Annual SEA Symposium Abstract
Culver-Stockton College
Canton MO
Corresponding Faculty Member: Esa Seegulam ([email protected])
Drew N Klocke
Isolation and Characterization of the Bacteriophage AvadaKedavra
Muhammad E Seegulam, Zachary M English, Alexander R Heaney, Julianna N Hollman, Bryan J Hunter, Drew N
Klocke
In this experiment we sought to isolate and characterize a novel bacteriophage from an environmental sample.
A soil sample was collected from the Northeast Missouri region and putative phages amplified using M.
smegmatis mc2155 as a bacterial host. The sample was subjected to several rounds of purification with the
aim of isolating a novel bacteriophage. The presence of bacteriophage was inferred by the formation of
clearings, or plaques, on bacterial lawns that had been infected with samples containing the putative phage.
Three new phages were discovered by the current cohort: JoeDirt26, SchmutzDaCat, and Pass. Genomic
analysis was conducted on bacteriophage Avadakedavra isolated by the 2015 cohort. The Avadakedavra
genome was 73721 base pairs long, with cluster L assignment and subcluster L1. Minor tail protein, membrane
domain protein, and capsid maturation protease were among the known products encoded by the 121
features identified in a preliminary analysis of the Avadakedavra genome, while 65 were found to have no
known function. Also encoded in the Avadakedavra genome is a single tRNA, tRNA-Cys(TGC). The programs
used for annotation include DNA Master, Phamerator, Starterator, HHpred, NCBI BLAST and PECAAN.
30
11th Annual SEA Symposium Abstract
Del Mar College
Corpus Christi TX
Corresponding Faculty Member: Daisy Zhang ([email protected])
Alexis S Trujillo
The Isolation, Characterization and Genomic Annotation of a A16
Bacteriophage ‘Lucyedi’
Alexis S Trujillo, John Ramirez, Lorie Leyva, John R Hatherill, Daiyuan Zhang
Bacteriophages are viruses that attack and kill their host bacteria. It has been estimated that there are over
10^31 bacteriophages present on our planet and more and more phages have been used for gene therapy and
treatment for antibiotic resistant bacterial infections. In this study, isolation of a novel bacteriophage ‘Lucyedi’
began with a soil enrichment procedure followed by several experiments to characterize the isolated phage
using its bacteria host Mycobacterium smegmatis. A high titer lysate was harvested for phage genomic DNA
isolation. The restriction digest analysis and genomic sequencing were conducted using the isolated DNA. The
phage morphology of ‘Lucyedi’ was studied by uranyl acetate negative staining and transmission electron
microscope imaging. Lysogens of ‘Lucyedi’ were isolated from spot tests with extra incubation and used for
phage efficiency studies on its host. The plaques of ‘Lucyedi’ indicated a lytic life cycle at the time of isolation.
The TEM images show ‘Lucyedi’ contains a capsid with 60nm in diameter and a tail 160 nm in length. The
restriction digest patterns suggested the ‘Lucyedi’ genome contains multiple recognition sites for BamHI, ClaI,
HaeIII and few sites for HindIII and EcoRI. Both the TEM image and restriction pattern imply that ‘Lucyedi’
belongs to the cluster A. The lysogen efficiency test of ‘Lucyedi’ indicated that 99.14% of the host
Mycobacterium smegmatis could be destroyed by this bacteriophage, which makes ‘Lucyedi’ a potential
candidate to develop a phage treatment for pathogenic Mycobacterium tuberculosis, a close species to M.
smegmatis. Lucyedi’s genome has been sequenced by the Pittsburgh Bacteriophage Institute. The dsDNA
genome is made up of 92 open reading frames or potential genes, with a genomic length of 52,987 BP and a
61.4% GC content. This particular phage belongs to the Cluster A, Subcluster A16. Cluster A is known as the
largest group of Actinobacteriophages with the majority of them being mycobacteriophages. The genome of
these phages have defined ends with 3’ overhangs. Currently only two bacteriophages including ‘Lucyedi’ have
been identified to belong in Subcluster A16.
31
11th Annual SEA Symposium Abstract
Doane University
Crete NE
Corresponding Faculty Member: Erin Doyle ([email protected])
Lilly Shatford-Adams
GENOME ANNOTATION OF MYCOBACTERIOPHAGES DUGGIE,
KLOPPINATOR, HOCUS IN THE B1 SUBCLUSTER
Lilly Shatford-Adams, Trevin Alberts, Ayden Benavides, Alexis Burke, Sam Coy, Nick Crespo, Kylie Crnkovich,
Salvador Delgadillo, Serenity Kinswoman, Anna Korte, Haley Miller, Brenna Mulvey, Reagan Peterson,
Makenna Weddle, Kade Wehrs, Dane M Bowder, Erin L Doyle
Micro-organisms called bacteriophages, or phages, are viruses found in abundance around the world.
Mycobacteriophages Duggie and Hocus were discovered in soil samples at Doane University in Crete, Nebraska
in September of 2018; Kloppinator was found by Johns Hopkins University in Baltimore, Maryland in 2012.
After isolating, purifying, and amplifying the bacteriophages, their structures were examined through
Transmission Electron Microscopy (TEM) images. Through this process, it was determined that all three phages
are of siphoviridae morphology, meaning they have non-enveloped capsule heads and have long, non-
contractile tails. Afterwards, the phages’ genomic DNA was extracted and sequenced, establishing that all
three are lytic and part of the B1 cluster. The lengths of the genomes range from 68,053 to 68,885 base pairs
with approximately 100 predicted genes in each. We used the software DNA Master, Starterator, Phamerator,
and BLAST in order to predict the start codons of open reading frames (ORFs) by comparing each feature and
genome to the features and genome of similar phage. Using HHpred and NCBI BLAST, we deduced the function
of each gene to find its importance in the genome. Most of the functions were found to be unknown which is
not uncommon for Mycobacteriophages. The information that we accumulated through our annotation can be
used by others in the future when they are predicting the same aspects of their genome.
32
11th Annual SEA Symposium Abstract
Dominican College of Blauvelt
Orangeburg NY
Corresponding Faculty Member: Bernadette Connors ([email protected])
Retrieval of Mycobacteriophage from Different Types of Soils
Darlenys Sanchez
In the current study, mycobacteriophages Penelope2018 (D1) and Guwapp (C1) were collected from compost-
enriched soil. Mycobacteriophage are viruses that infect members of the genus Mycobacterium. It is advised
to search for these bacteriophage in moist soil rich with organic matter. It is hypothesized that phages will be
retained in rich soil and not retained in sand or clay. Five soil types were tested, namely, commercial potting
soil, clay, compost, peat, and sand. In addition, three types of clay were analyzed. The soils were sterilized and
phage were added along with phage isolation buffer and/or host bacterium. The mixtures were incubated at
30°C for 3 and 5 days, after which phage presence was tested using a spot plate procedure. Results indicate
that clay does not support phage retention, and the titer of the phage decreased significantly within 5 days.
The sand and peat retained phage to the greatest degree, with potting soil and compost to a lower degree.
Future studies include an assessment of pH in the ability to retrieve phage from the various soil types, as well
as aeration status of the soil, in terms of the ability to retrieve phage from the soil. Annotations of these
genomes was completed, and an analysis into the amino acids found in the major tail subunit and capsid
proteins will be done. This research informs students isolating and purifying phage that soils such as sand may
also harbor mycobacteriophage.
33
11thAnnualSEASymposiumAbstract
DrexelUniversity
PhiladelphiaPA
CorrespondingFacultyMember:SusanGurney([email protected])
NicholasBarbieri
ErinGallagher
NovelBacteriophagesAgainstEnvironmentalPhactors–Phagestability
PuttotheTest!
NicholasBarbieri,ErinGallagher,AmalAhmed,SanyaAilani,DeekshaAjeya,MervinAlexander,Gabriela
Almanzar,ShehbeelArif,NeilBal,PoojaBalar,SamBeane,VincentBeggarly,SumaiyaBegum,AtharvaBidaye,
MegBindiganavale,AmberBolli,NowrinBorsha,SydneyBucher,SarahBusby,StevenDeLuca,ChloëDenley,
EmmettDessimoz,SpoorthiDingari,CapriDiSaverio,VesaDobi,AlexanderFahmy,PrachiGaddam,AyaanGill,
DaleGlova,NishuntaGopalasundaram,VirginiaGranato,SayemaHakim,SamuelHawk,DakotaHeizman,
AaronJeong,KaileeJohnson,GiannaJoyner,SammyKhalouf,ChaeyeonKim,JoyceKim,NilaKirupaharan,
HetalLad,YongHuiLin,VincentLiu,KaylenLouie,IsabellaMancini,ZacharyMandell,TracyMarcelis,Bhakti
Marfatia,AkosMarfo‐Sarbeng,KathleenMarsili,RyneishaMcKenzie,DerekMock,RiyazMohamed,AssalNasir,
AnhNguyenQuach,IsabellaPappano,PallaviPareek,NidhiPatel,PrarthanaPatel,ShrutiPatel,TharaPatel,
ArathiPillai,AnjaliPradhan,ShreyPradhan,AnjaniRavi,SophieRedila,ByronRuf,MekhalaSantebennur,Elana
Sargent,ShivashreeSekar,ElisaSelamaj,SimranShamith,MekhalaSantebennur,ElanaSargent,Shivashree
Sekar,ElisaSelamaj,SimranShamith,HarshSharma,KumalSiddiq,SeenaSoroush,AnnikaSurapaneni,Almas
Thaha,SummerThompson,AmyVarghese,AkhilVindyala,PavithraVinnakota,HaiderVirk,NishaVora,Lincoln
Wu,MerryXiang,SethZurlo,RituDalia,SusanGurney,SvetlanaKhakhina
IntheFallof2018,DrexelUniversitystudentsisolated36novelbacteriophagesusingMicrobacteriumfoliorum
asahost.Allphageswereisolatedusingenrichedisolationand8ofthemweresequenced.TheIllumina
sequencingofthesephagesdemonstratedthatallphageshavelyticcellcycle,siphoviridaemorphologyand
belongtoEA1,EA4subclustersandECcluster.ThesephagesweresuccessfullyannotatedusingDNAMaster,
Phamerator,NCBIBlastandPECAANandsubmittedtoGenBank.DuringtheSpringquarter,weinvestigated
theeffectofvaryingenvironmentalfactorsonphagestabilitybyevaluatingchangesintheplaqueforming
units(pfu)observed.PhageswereexposedtoacidicorbasicpH,hightemperature,differentglucose
concentrationsorUVlight.Additionally,theprotectiveeffectofwheyproteinconcentrate(WPC)andalpha‐
34
lactalbuminonphagestability,whenexposedtohigh‐temperature,wasalsoinvestigated.Fullplateplaque
assayswereconductedinalltheexperiments.Ifphagestabilitywasadverselyaffected,thenumberofpfu
woulddecrease.Conversely,anincreaseinpfuwouldindicatethatthetestedconditionhasenhancedthe
abilityofthephagestoinfectthebacterialcell.Ourresultsdemonstratedthatexposingphagestoacidicor
basicconditionsorUVlightshowedadecreaseinpfucounts.Anotherinterestingobservationwasthat
exposuretoglucosealsosignificantlydecreasedphagestability,probablyduetoosmoticshockandphage
lysis.Otherexperimentsshowedthataddingwheyproteintophagelysatesstabilizedthephageduringhigh‐
temperatureshock,suggestingthatithasaprotectiveeffectwhichenhancedphageinfectivity.Surprisingly,
alpha‐lactalbuminhadanoppositeeffectonphagestability,whenexposedtohightemperature,because
decreasedpfuresultswereobservedwhencomparedtothecontrolplates(usingphagebufferalone).Based
ontheseobservationsweconcludethatphagescantolerateexposuretoarangeofenvironmentalfactorsand
arestillabletoperformbacterialcellinfections.
35
11th Annual SEA Symposium Abstract
Durham Technical Community College
Durham NC
Corresponding Faculty Member: Marie Fogarty ([email protected])
Kieran H Murthy
LOST AND PHOUND: Identifying Diverse Phages Using DOGEMS and
Annotation of Sixama & MinecraftSteve
Kieran H Murthy, Caleb A Christie, Alimatou S Diallo, Zavier Dixon, Peyton M McIntosh, Maggie G Rosen, Lee
M Simpson, Marie P Fogarty
Recently, phage therapy is bring reconsidered as a viable alternative to antibiotics. This movement has created
a drive to collect, document and annotate as many phages as possible. In fall 2018, the Phage Hunters
collected soil samples from the Durham area of NC, resulting in isolation of 16 phages using the host Gordonia
terrae. Sixama, discovered by direct isolation, was sequenced individually. DNA from ten of the remaining
phages was combined and sequenced using the DOGEMS approach. The spring 2019 Phage Hunters annotated
Sixama’s genome using DNAMaster and PECAAN. Sixama was found to be from the uncommon cluster DS. This
made annotation somewhat challenging due to lack of comparative data. Following sequencing and
assembling of the DOGEMS sample, a further six complete genomes were identified, along with two mostly
complete genomes and one partially complete genome - all from different clusters. To match phage identity to
genome sequence, we designed primers specific to each of the nine contig sequences using NCBI Primer-
BLAST. Specificity of each primer set for its cluster was confirmed using phagesdb BLAST. Using DNA from each
phage sample, PCR was carried out for all nine contigs. The ideal and expected result was that only one of the
ten DNA samples would amplify for each contig tested. Using this approach, seven out of the ten phages were
successfully matched with their genomes. MinecraftSteve, a subcluster A15 phage, was subsequently selected
for annotation. 167 genes were annotated for Sixama and 98 genes for MinecraftSteve. While only three
tRNAs were annotated in MinecraftSteve, 29 were annotated in Sixama. Interestingly, Sixama has a GC content
of 52.7%, quite different from that of Gordonia terrae (67.8%), while MinecraftSteve has a GC content of
62.0%. The excess of tRNAs encoded by Sixama may help compensate for the compositional differences
between the phage and host genomes.
1
Both annotated phages are temperate, but only Sixama has an
integrase gene. Instead, MinecraftSteve encodes parA and parB, which likely allows the prophage to form a
stable plasmid within the host cell
2
. Five possible sites were identified where Sixama may integrate into its host
genome. Three of the potential integration sites overlap tRNA genes within the host, a common location
where temperate phages integrate into bacterial genomes. Additionally in MinecraftSteve, a translational
frameshift was annotated in the tail assembly chaperone genes. In conclusion, using the DOGEMS approach
we demonstrated that collecting phages from various locations and environments may yield a more diverse
range of phages within the clasroom. Phages were isolated from nine different clusters - two phage genomes
36
were fully annotated and six further phage genome sequences identified through DOGEMS are available for
annotation.
1. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1987346/
2. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4998052/
37
11th Annual SEA Symposium Abstract
The Evergreen State College
Olympia WA
Corresponding Faculty Member: Jim Neitzel ([email protected])
Ashley Walker
A BLAST Result from the Past: Isolation and Analysis of Archived Cluster A6
Phage Hexamo
Ashley Walker, Tessa Jacobs, Emily Smith, Alberto Napuli, James Neitzel
The student participants in the 2014-15 year of the SEA-¬PHAGE project were members of the interdisciplinary
program Introduction to Natural Sciences, a year-¬long, full-¬time learning community with integrated
instruction in biology, chemistry, and science process skills. During the fall quarter students collected and
purified phages using enrichment cultures of Mycobacterium smegmatis mc² 155 at 37 C. During this cycle 23
phages were isolated from local soils, purified, and entered into the PhagesDB collection. During fall 2017,
during a DOGEMS (Deconvolution of Genomes after En Mass Sequencing) run a new A6 phage was assembled
and PCR experiments identified this phage as the archived Hexamo from this collection. As relatively few A6
genomes had been completely annotated at that point, we used the supplied total sequence to fully annotate
the genome of this phage.
This set of phages had their DNA purified and analyzed by restriction enzyme digestion and gel electrophoresis.
Hexamo was visualized by transmission electron microscopy after negative staining with uranyl acetate. This
resulted in a clear image which appeared to be siphoviridae. DNA from these phages was sequenced using the
Illumina process at the Pittsburg Bacteriophage Institute. The sequence of Hexamo revealed a 52,359 bp linear
double stranded DNA genome with a sticky ten bp 3’ overhang and with a GC content of 61.4 %. Analysis of the
sequence of this phage confirmed that it was a siphoviridae in the A6 subcluster. BLASTn results indicated its
closest relative was Artemis2UCLA. The genome was analyzed for potential protein coding open¬-reading
frames using Glimmer and GeneMark, and protein functions were predicted by BLASTp and HHPred, as well as
examining synteny with related phages using Phamerator. Predicted starts were also examined using
Starterator. Preliminary results suggest the presence of 105 protein coding genes and a predicted translational
frame shift. Particular care was taken in the region around the minor tail proteins and head-tail connector
region to use best available data to annotate this region. All expected genes for a temperate replication mode
were present. We identified 3 tRNA genes using ARAGORN and tRNAscan-SE. The final annotation passed
quality control and is now in GenBank as accession MK 359360.
38
11th Annual SEA Symposium Abstract
Florida International University
Miami FL
Corresponding Faculty Member: Patricia Waikel ([email protected])
Karina Gonzalez
Phylogenetic and protein structure comparison of minor tail proteins
among F cluster phages
Daniel Cambron, Ana Ruas, Karina Gonzalez
The annotation of phage genomes commonly results in the annotation of multiple minor tail proteins per
genome, without distinguishing whether there are distinctive differences or functions of these multiple minor
tail proteins. While research into the evolution of long-tailed phages has focused on bench work and functional
annotation, comparisons of the protein structure of the multiple minor tail proteins harbored by these phages
are lacking. We identified 78 minor tail proteins present in ten phages from the F cluster representing
subclusters F1, F2, F3, and F4. To visualize the evolutionary relationship among these minor tail proteins, we
constructed a maximum likelihood phylogenetic tree using PROMALS3D and IQ-TREE. We then identified
distinct clades of minor tail proteins from the phylogenetic tree and predicted the protein structure for one
representative of each clade using the program SWISS-MODEL. Similarities in 3D structure between proteins
within the same clade and across clades were examined. By examining how these proteins group in the
phylogenetic analysis and whether they cluster according to the sub-cluster they belong to or if they cluster
across different phages, we will develop a greater understanding of the diversity and conservation of minor tail
proteins and their structures. Future research in this area should focus on examining the structural
conservation of minor tail proteins across phages of different clusters and, ultimately, different hosts.
39
11thAnnualSEASymposiumAbstract
GeorgeMasonUniversity
FairfaxVA
CorrespondingFacultyMember:AnneScherer([email protected])
JohnPerkins
LaurenMPincus
IdentificationoftwoGordoniaphages:SteamedHamsandSuerte
AlenaArlova,DionMBlackmon,SiannaBurnett,DominicECruz,DeleramDastan,JuanDEsteban‐Lopez,Jorge
DFernandezDavilla,SaraHull,AlexIrizarry,LuluLwin,AnamNaz,JohnPerkins,LaurenMPincus,NajiyahA
Prome,ShahSaeed,NicolaSolares,AnnieHTran,TinaZhen,WanyueZou,MohamadAAlayouni,AnneE
Scherer,BonnieMadden,BrianNguyen
Herewedescribetwonovelbacteriophages,SteamedHamsandSuerte,isolatedinNorthernVirginiaviathe
enrichmentmethodusingGordoniarubripertinctaNRRLB‐16540asthehost.Bothgenomesweresequenced
usingIlluminasequencingatthePittsburghBacteriophageInstitute.
SteamedHams(namedforafamousAlbanydelicacy)isalyticphagethatformssmallclearplaquesandisa
clusterCTGordoniaphage.Thegenomeis44,571bpinlengthandhasaGCcontentof59.9%.Itwasisolated
fromasoilsampletakennearacommunitygardeninAlexandria,VA.SteamedHamshas63predictedgene
products.
Suerte(“lucky”inSpanish)isaclusterCZGordoniaphagethatwasisolatedfromabusysidewalkonthe
GeorgeMasonUniversitycampusinFairfax,VA.Suerteformssmallclearplaques,thoughclusterCZphages
aretypicallytemperate.Thegenomeis47,306bplongandhasGCcontentof66.5%.Suertehas76predicted
geneproductsincludinggenesconsistentwithatemperatelifestylesuchasatyrosineintegrase.Wehavealso
identifiedthecommoncoresequenceusedtointegrateintothehostgenomeduringlysogeny.Suertehasa
potentialtranslationalframeshiftinthetailassemblychaperone.Tobetteridentifytheslipperysite,we
developedsoftware,codedinPython,tohelpcharacterizethesiteofthetranslationalframeshiftinthetail
assemblychaperonegenebysearchingforconservedslipperysequencesacrosstheCZcluster.
40
11th Annual SEA Symposium Abstract
Gonzaga University
Spokane WA
Corresponding Faculty Member: Kirk Anders ([email protected])
Ian Melder
A jumbo discovery: Omphalos is the largest actinobacteriophage found to
date
Jared DeBruin, Eleanor Johnson, Matthew McCaw, Sarah Vetsch, Ian Melder, Meghan Casey, Kate Delaney,
Grace Garza, Christina Holland, Darby Howat, Martina Hunt, Logan James, Caroline Kotson, Rika Linman,
Angela Palant, Skylar Riley, Olivia Roty, Spring 2019 Genetics Lab students, Kirk Anders, Ann-Scott Ettinger,
William Ettinger, Marta Fay, Marianne Poxleitner, Sean McKenzie
To expand knowledge of bacteriophage diversity in the phylum Actinobacteria, we searched for phages that
could grow on the host Microbacterium testaceum NRRL B-59317. M. testaceum isolates typically live on and
in plants without causing disease symptoms. M. testaceum NRRL B-59317, however, was found in a NASA
clean room during assembly of the Mars lander, Phoenix. Phage Omphalos was isolated from soil sampled
from a pumpkin garden and enriched in medium containing M. testaceum. Omphalos produced large, turbid
plaques at 30 deg C with an irregular, multi-ringed appearance. Clear plaques routinely appeared on these
plates, but we have not propagated them to test heritability. At 37 deg C, all plaques were clear. TEM showed
that Omphalos is a non-contractile tailed phage (capsid width, 100 nm; tail length, 250 nm). The Omphalos
genome is 235,841 bp in length, which places it in the group of >200 kb phages known as giant or jumbo
phages. It is the first jumbo phage discovered in the Actinobacteria. The genome ends contain long, direct
terminal repeats of 18,632 bp. The GC content of Omphalos is 34%, whereas the M. testaceum genome is 70%
GC. Omphalos contains 318 predicted protein-coding genes, 33 of which are duplicated in the direct terminal
repeats, and two tRNA genes. The genome is a singleton among actinobacteriophages, but is distantly related
to a clade of extrachromosomal DNAs in bacterial genomes which are annotated as large plasmids, as well as
the singleton Bacillus phage bp0305Phi836 and the singleton Acinetobacter phage vB-AbaM-ME3. In total we
identified 37 supposedly bacterial contigs or plasmids related to Omphalos, all of which were approximately
the size of jumbo phage genomes (150-800 kb) and contained terminase, portal, and capsid proteins. Most of
these were found in the genomes of species in the phylum Firmicutes, a phylum distantly related to the
Actinobacteria which has convergently evolved a gram-positive cell wall morphology. The DNA sequences most
closely related to Omphalos all came from bacteria in the genus Bacillus, and shared on average 127 genes
with Omphalos (as determined by blastp similarity). Many shared genes are syntenic between Omphalos and
the Bacillus sequences. Regions of 80-90 kb containing structural genes encoding terminase, portal, major
capsid protein, and tail proteins are in nearly identical order. The strongest alignments show 35-75% amino
41
acid identity across the length of the proteins. The major capsid proteins, for example, share 71% aa identity.
To the right of this region, genes with functions related to DNA replication, DNA metabolism, and
recombination are shared between Omphalos and the Bacillus sequences, but gene order is not as well
conserved.
42
11th Annual SEA Symposium Abstract
Hampden-Sydney College
Hampden-Sydney VA
Corresponding Faculty Member: Mike Wolyniak ([email protected])
Damian Martinez Pineda
Phinding Phages a Good Home: A Comparative Genomic Survey of 7
adopted Cluster A Mycobacterium smegmatis phages
Damian Martinez Pineda, David Z Bushhouse, Blake A Martin, Austin C Murphy, Harrison R Whaley, Zachary P
Wiggin, Corey J Williams, Michael J Wolyniak
While considerable work has been done by SEA-PHAGES and other groups to characterize Mycobacterium
smegmatis cluster A phages, a large number of isolated cluster A phages remain uncharacterized and could
potentially add invaluable insights to bacteriophage evolution and lifestyle. In this spirit, we adopted 7 cluster
A M. smegmatis bacteriophages from SEA-PHAGES (Rutherferd (A1), Whabigail7 (A2), Veracruz (A3),
Bumblebee11 (A4), Scorpia (A5), Jordennis (A6), Expelliarmus (A8)) and did a comparative genomic annotation
of the group. As shown by previous SEA-PHAGES work, all 7 phages displayed similar sizes and overall genomic
architecture despite their discoveries from disparate locations across the United States. Despite these overall
similarities, our study also revealed unique features in individual or subgroups of the 7 phages. Among these
features were a 430 basepair gap in the Veracruz genome revealed by BLAST to represent a transfer event
from the M. smegmatis genome, immunity repressor proteins in similar locations near the back ends of the
Expelliarmus and Bumblebee11 genomes, and a section of the Rutherferd genome that defied the traditional
front-half/back-half opposing direction of ORFs traditionally found in this cluster. Taken together, this study
reinforces what has been previously revealed about the genomic architecture of M. smegmatis cluster A
phages while revealing potentially intriguing individual adaptations that individual phages have made across
different geographical locations.
43
11th Annual SEA Symposium Abstract
Hillsborough Community College
Tampa FL
Corresponding Faculty Member: Margaret Hopson-Fernandes ([email protected])
Michael Alpert
Genomic Analysis of Microbacterium Phage HarperAnne
Michael Alpert, Nathalia Assaad, Ginelle Bonnelly, Serina Bush, Brandi Fafrak, Courtez Greene, Joseph
Murphy, Chau Phan, Leo Rea, Margaret Hopson-Fernandes, Christine Logue, Lisa Smith, David Wingfield, Jim
Wysong
Antibiotic resistant bacterial infections are projected to be the leading cause of death by the year 2050.
Bacteriophages, viruses that exclusively infect bacterial cells, are a promising solution to this pending health
crisis. Phages are the most abundant biological particle on the planet. They are evolutionarily ancient and
genetically highly diverse. Studying phage genomes gives valuable insight into the proteins coded for in phage
DNA that allow them to infect their host and avoid their hosts’ defenses. HarperAnne was discovered during
the wet lab portion of the course in an organic soil sample collected in Pinellas County on September 11, 2018.
This lytic phage infects the host Microbacterium foliorum NRRL B-24224 SEA, a nonpathogenic relative of
infectious bacteria including Mycobacterium abscessus. Phage DNA was extracted using HHMI SEA-PHAGES
protocols. Sequencing, completed by the Pittsburgh Bacteriophage Institute, revealed that HarperAnne is a
Cluster EE phage with a genome length of 17,116 bp, 26 genes, a 9 bp 3’ sticky overhang, and 68.8% GC
content. BLAST results indicated the closest annotated phage relatives are Noelani and Miaurora. The purpose
of this study was to compare the genome of HarperAnne to phages in the same pham to identify similar and
unique gene products. We hypothesized that there would be synteny among structural and assembly function
genes and that proteins with the same function would have regions of high amino acid identity. We compared
HarperAnne to phages in the pham using several different predictive programs including Phamerator and
HHPred. We found a high degree of similarity of structural and assembly function genes. Structural genes
identified include terminase, portal protein, major capsid protein, head-to-tail connector complex protein,
minor tail protein, tail assembly chaperone, and lysin A. There is one orpham. No tRNAs are present. Our
results indicate a high degree of similarity in gene products between HarperAnne and other phages from the
same cluster. Our findings will contribute additional information to the relatively limited body of knowledge
about the diversity within and between phages that infect different Actinobacterial hosts.
44
11th Annual SEA Symposium Abstract
Hope College
Holland MI
Corresponding Faculty Member: Joseph Stukey ([email protected])
Matthew Gross
Mycobacteriophages Paphu and Philly: Two New Members of Two
Familiar Clusters
Matthew Gross, Megan Lopez, Emma Beemer, Isabelle Bertolone, Kayla Brady, Mikayla Coombs, Sara
Filippelli, Jessica Liu, Morgan Malaga, Anna Molloy, Shane McAuthur, Jonathan Outen, Victoria Parker,
Carleigh Robinson, Hannah Tegtmeyer, Mikayla Zobeck
Sixteen new mycobacteriophages were isolated from soil samples collected around the state of Michigan and
parts of the United States. All phages were capable of infecting Mycobacterium smegmatis and were isolated
through either enrichment or direct plating at 32°C. A variety of plaque morphologies were produced based on
size, shape, and clarity; both lytic and temperate phages appear represented in this collection. The
mycobacteriophages, Paphu and Philly, were chosen as two of three phages for complete genome sequencing
and comparative genomic analyses. The predominant plaque produced by Paphu after 48 hours at 32°C was
circular and was approximately 2-3 mm in diameter. The plaque morphology was clear with a turbid ring
resulting in a halo visual. The predominant plaque produced by Philly after 48 hours at 32°C was circular, clear,
and was approximately 1 mm in diameter. The complete genome sequence for Paphu revealed a relationship
to mycobacteriophages of cluster A, subcluster A1, which now contains 154 sequenced members. Paphu is
most similar to the A1 phages AFIS and Blue. The genome size of Paphu is 51,159 bp, which is smaller than
most of the sequenced A1 mycobacteriophages. However, it has one of the highest GC contents of A1 phages
at 64.1%. The Paphu genome contains 92 protein-encoding genes and no tRNA or tmRNA genes. Despite the
genomic identities organizing phages into subcluster A1, they show marked levels of genomic diversity,
scattered throughout their genomes. The complete genome sequence for Philly revealed a relationship to
mycobacteriophages of cluster B, subcluster B3, which now contains 31 sequenced members. Interestingly, all
but a few B3 phages have been isolated between Michigan and Washington, D.C. The genome of Philly is
68,523 bp, which is smaller than most of the sequenced B3 mycobacteriophages. It has a GC content of 67.5%,
similar to other B3 phages as well as the host M. smegmatis (67.4%). The Philly genome contains 102 protein-
encoding genes and no tRNA or tmRNA genes. Phages in subcluster B3 share very high sequence identity
throughout the genome lengths. Philly maintains this pattern, being nearly identical to mycobacteriophages
Heathcliff, Athena, and Bernado despite their isolation in different years (2003-present) and in different
geographical locations. However, Philly does contain some genomic variability around genes 2, 5, and 56. And
like all B3 phages, Philly also contains many short sequence repeats throughout its genome.
45
11th Annual SEA Symposium Abstract
Hope College
Holland MI
Corresponding Faculty Member: Joseph Stukey ([email protected])
Joseph Stukey
6° of Separation: The Impact of Temperature on Isolation of Cluster K
Mycobacteriophages
Bethany Van Houten, Geordan Stukey, Adam Krahn, Angela Vito, Gloria Chang, Frank Moen, Adam Slater,
Aaron Best, Joseph Stukey
Mycobacteriophages are viruses that infect mycobacterial hosts. Over 1750 mycobacteriophages are
organized into 39 distinct clusters based on genetic similarity. Some cluster A and K mycobacteriophages can
also infect Mycobacterium tuberculosis, a distinction of potential medical importance. Hope College SEA-
PHAGES students have been isolating possible cluster K mycobacteriophages at a higher frequency (≈ 2x) after
lowering the isolation temperature from 37°C to about 32°C (30°-32°C). These 32°C-isolated phages were
unable to propagate at 42°C. PCR analysis supported cluster K classification for many possible cluster K phages
isolated at 32°C (23 of 30 tested of a total of 43), but few isolated at 37°C (3 out of a total of 23). All 3 PCR-
supported K phages isolated at 37°C grew at 42°C. We have sequenced 16 of the possible cluster K phages,
and found all PCR-supported phages, including the 3 isolated at 37°C, belong to cluster K. We hypothesize that
the observed higher Cluster K phage isolation frequency is at least partly due to a relative growth advantage at
lower temperatures that is fully compromised at 42°C. Results from experiments testing specific growth
parameters, including phage thermostability, adsorption rate, latent period, and burst size, are consistent with
our hypothesis. In an effort to determine the step of the lytic cycle blocked at 42°C, a temperature down-shift
experiment (42°C shifted down to 32°C) was performed on Hyperbowlee, a cluster K phage isolated at 32°C
and growth inhibited at 42°C. Assays were performed testing two different 42°C hold time lengths. Both
assays produced a consistent shift in time to first release of new Hyperbowlee phage, to a point about 85
minutes following the temperature down-shift. These results and subsequent tests indicated that phage
infection was blocked, post DNA transfer, at about 20-30 minutes into the 32°C lytic cycle. Additional
investigations into phage stability under drying conditions and competition growth assays are underway.
46
11th Annual SEA Symposium Abstract
Howard University
Washington DC
Corresponding Faculty Member: Mary Ayuk ([email protected])
A Kaleidoscope of phage Clusters
Kedus . Ashagre , Amia . Black, Laraine Cheung, Diana Effiom, Folasade Fashina , Sanaa Haamen, Ramata
Haidara , Amber A Johnson, Esther Nwozo , Delandra Robinson, Triniti Sims, D'nai N Thomas, Students of
HU- PHAGES 2018-2019, Glory Bassey, Victoria Brooks, Michelle L Fernando, Madison Moore, Jerome
Oliver, Benedict Quagraine , Swagota Roy , Michael Smith, Adrian A Allen, Mary A Ayuk, Ayele Gugssa,
Courtney J Robinson, Ghosh Somiranjan, Hemayet Ullah , Anderson Winston , . .
Mycobacteriophages are viruses that infect mycobacterial hosts, including Mycobacterium tuberculosis and
Mycobacterium smegmatis. These are studied for purposes which include viral ecology, epidemiology, tools in
molecular biology and in the development of therapeutics. The aim of this project was to explore phage
diversity through isolation and characterization of unique mycobacteriophages from 125 soil samples collected
from the Howard university environment, using Mycobacterium smegmatis as the host. Almost all the phages
were derived from the enrichment culture.
Subsequently, phages were purified using standard protocols, lysates generated, DNA was isolated,
quantitated, characterized and representative samples sequenced by the Pittsburgh Bacteriophage Institute,
using Illumina Sequencing. Sequenced genomes are currently being annotated, (except Delton which is already
approved with GenBank Accession MK559427), using various in-silico programs. With Dallas and Jonghyun
identified as temperate, their lysogens are been used to characterize other phages. Furthermore, all phages
are being utilized for identifying patterns of phage sensitivity/insensitivity—immunity testing using wildtype M.
smegmatis mc2155 and generate lysogens.
Data analysis indicate that sequenced phages can be divided into five clusters: B (phage SynergyX, Abinghost
and Bananafish; C (Blackbrain, Cactojaque, Kboogie, Trinitium and YoungMoneymata ) G1 (Jonghyun ), J
(Dallas) and a singleton (Onyinye ). GC content ranged from 64.7- 68.9% and was identified for morphotypes
Siphoviridae and Myoviridae. In addition, preliminary data from sensitivity/insensitivity testing suggests that
several of these phages are lytic.
Availability of the genomic information from such diverse clusters will help the study of bacteriophage
diversity and their evolutionary mechanisms that give rise to the vast diversity seen in the bacteriophages."
47
11th Annual SEA Symposium Abstract
Illinois Wesleyan University
Bloomington IL
Corresponding Faculty Member: Dave Bollivar ([email protected])
Katie Vogler
Jackson Rapala
A Phamily of Phages: Sucha, Warren, and Celaena
Katie Vogler, Jackson Rapala, Emmet Agting, Vanessa Chapa, Matt Crosse, Ivy Do, Maeghan Eaker, Anjali
Nimavat, Manish Pathuri, Kylie Spiegel, Saralexis Torres, Lane Warren, Saylor Williams, Richard Alvey, David
Bollivar
Bacteriophages are the most numerous known biological entities on Earth yet relatively few have been
cultured and even fewer have had their genomes sequenced and analyzed. Throughout the 2018-2019 school
year students at Illinois Wesleyan University were able to discover 16 unique bacteriophages that infect the
host Microbacterium foliorum NRRL B-24224 SEA. From these, three were selected to be sequenced and
functions were assigned for their identified genes using PECAAN and DNA Master. These phages were chosen
because they showed the greatest probability of being unique based on laboratory experiments including
lysogen testing, polymerase chain reaction (PCR) with primers designed to detect the most common M.
foliorum phage clusters, and because of their interesting plaque morphologies and transmission electron
micrographs. Lysogeny did not occur for any of these phages and the absence of integrase genes in the
genomes supports this observation, suggesting they are virulent with a lytic lifestyle. The three Siphoviridae
phages sequenced were Sucha, Warren, and Celaena. Warren and Sucha were paired with singletons to form
the new clusters GA and EJ respectively. Celaena is a new member of the EB cluster. Despite being in different
clusters, annotation of Sucha and Warren showed that these two phages shared many highly similar predicted
proteins with many genes being in the same pham. In a Splitstree analysis of the sequenced M. foliorum
phages, these EJ and GA clusters appear to be closely related but are quite distant from Celaena.
48
11th Annual SEA Symposium Abstract
Indian River State College
Fort Pierce FL
Corresponding Faculty Member: Tom D'Elia ([email protected])
Denisse L Hasan
Individual and en masse sequencing of 10 Actinobacteriophage from 7
clusters and one singleton
Denisse L Hasan, Helen Wiersma-Koch, Tom D'Elia
Prior to the 2018-2019 academic year, Indian River State College successfully isolated 50 Actinobacteriophage
from soil samples as a part of the HHMI SEA-PHAGES program. Of the isolated phages, 16 have been
sequenced with a total of 9 phages being classified as belonging to cluster A. The other phage are classified
into 7 different clusters. In order to isolate a broader range of phage outside of cluster A, the IRSC program
has implemented a new strategy leading to the sequencing of 10 Actinobacteriophage genomes in 2018-2019.
As a result, the overall phage diversity at IRSC has expanded, with a total of 26 genomes sequenced
representing 11 clusters and one singleton. Three bacteriophage were selected for individual sequencing.
Two of these phage, Yeet (J) and Lolavinca (C1), belong to clusters not previously isolated at IRSC. The third
individually sequenced phage, Hulk, is the second EE cluster microbacteriophage isolated at IRSC. DNA
available from the remaining 7 mycobacteriophages was pooled together for en masse sequencing in the
DOGEMS project. Through this process, the genomes of the most unique phage are able to be assembled for
annotation. This sequencing strategy successfully yielded 7 individual genomes. The singleton IdentityCrisis
was the most unique phage sequenced, having the smallest genome size of any mycobacteriophage. The
remaining 6 genomes were from bacteriophage that belong to clusters or subclusters not previously identified
at IRSC (IdentityCrisis, singleton; Cintron, A4; Magpie, B; Mangeria, C; Harella, E; Yeet, J; Whitty, T). These
findings also add new phage to clusters that are still relatively low in abundance, including clusters T and J,
which have only 7 and 37 phage, respectively. Utilizing the DOGEMS strategy for genome sequencing revealed
that soil in Southeast Florida is very diverse in mycobacteriophage. As a result, a novel singleton has been
sequenced and additional phage have been added to clusters T and J.
49
11th Annual SEA Symposium Abstract
Indiana University of Pennsylvania
Indiana PA
Corresponding Faculty Member: Cuong Diep ([email protected])
Claire Shemon
Beaglebox: a Mycobacterium smegmatis phage isolated from a dog kennel
near IUP
Claire Shemon, Jacob King, Kaitlyn Murphy, Hayley Kepple, Brandon Vought, Seema Bharathan, Carl Luciano,
Cuong Diep
Beaglebox is a B1 subcluster lytic M. smegmatis phage that was isolated at a former dog kennel near the
campus of Indiana University of Pennsylvania (isolated by K. Murphy, H. Kepple, B. Vought in 2017). It has a
Siphoviridae morphotype and creates small clear plaques with fuzzy edges. The genome consists of 68,418 bp
with a 66.5% GC content, coding for 103 genes predicted by auto-annotation. During our annotation, we
deleted 5 genes (gp3, 10, 45, 78, 81) due to lack of BLAST matches and poor or no coding potential. We also
added 2 new genes between large gaps that had BLAST matches and coding potential. The first added gene
was between gp11-12 and the second was between gp69-70. Beagle also had one orpham with 468 bp (gp58).
Our final annotation showed that Beaglebox contained 100 total genes (all coding for proteins) with 49% of
them being assigned functions. Although a holin gene is yet to be identified in this subcluster, we found that
our gp16 partially matched holin in the Corynebacterium phage Juicebox (38% identity and E=1e-10). Further
experimentation will be needed to confirm whether this is a true holin gene or not.
50
11th Annual SEA Symposium Abstract
James Madison University
Harrisonburg VA
Corresponding Faculty Member: Louise Temple ([email protected])
Tiyam Assadapour
Redefining “Multiplicity of Infection”: Two Hosts and Two Phages in One
Class
Tiyam Assadapour, Jawad Ahmed, Simon Anderson, Kurt Espinosa, Trniti Gadsden, Allison Graham, William
Hajjar, Trent Howard, Olivia Lacafta, Katelyn Matney, Katie Matsen, Johnathan Osu, Easton Rupe, Hong Sang,
SoeYu Wadi, Jackson McNeal
With the advent of antibiotic resistance, alternative methods of treatment, such as phage therapy, are being
investigated in order to lessen global dependence on antibiotics. The discovery of novel bacteriophages is
imperative to designing efficacious phage treatments. Undergraduates involved in JMU’s Viral Discovery
courses propagated phages on Pseudomonas putida, a gram negative aerobic soil bacterium involved in
industrial production and bioremediation. P. putida serves as a harmless surrogate for P. aeruginosa, a
significant pathogen of patients with cystic fibrosis and immunocompromised burn victims. P. aeruginosa is
known to be highly resistant to multiple classes of antibiotics and thus is an ideal target for phage therapy.
Zuri, a siphovirus, was isolated on P. putida from garden soil collected in Harrisonburg, VA.
Early in the semester, we discovered that a bacterium similar in morphology and color to P. putida was lurking
as a “contaminant” in our bacterial cultures. After isolating a pure culture and performing 16s r-DNA
sequencing, we identified this bacterium as an uncharacterized species of Microbacterium and tentatively
designated it M. ISAT203. Microbacterium is a gram positive aerobic soil bacterium, commonly used in
commercial cheese production, that causes infections in plants and rarely in humans. We isolated several
phages on the Microbacterium host, and Phage IamGroot, found in garden soil from Damascus, MD, was
chosen for genome sequencing and analysis. Isolation and purification of the bacteriophages was performed
according to standard SEA-PHAGES protocols; however, a simplified alternative DNA purification procedure
was implemented. Phages were sequenced at North Carolina State University Genomic Sciences Laboratory
(Zuri) and the Pittsburgh Bacteriophage Institute (IamGroot). The ~1 million raw data reads were randomly cut
to 125,000 reads, then assembled using Newbler into a single contig for each phage, with >50x coverage.
Sequence analysis and annotation were performed according to SEA-PHAGES methodology, and Phage Term
(Galaxy) was used to confirm the ends and DNA packaging method.
Zuri is a terminally redundant and circularly permuted phage containing a 75,853 base pair (bp) genome with a
53.5% GC content. One hundred protein coding genes and 3 tRNA genes were predicted. Using BLAST, Zuri was
51
found to be distantly related to Pseudomonas phages Inbricus and phiAxp-3 (~30% coverage). IamGroot has a
45,625 bp genome containing 74 protein coding genes with a 70% GC content. Fixed ends are predicted with
457 bp direct repeats and an 11 bp 3’ overhang. IamGroot is somewhat related to Microbacterium phages
Percival and Floof (65% coverage). There is an unusual 300 bp gap in IamGroot, but the region lacks any
obvious coding potential. Both phages are temperate, given the presence of recombinase and other related
genes.
52
11th Annual SEA Symposium Abstract
James Madison University
Harrisonburg VA
Corresponding Faculty Member: Steve Cresawn ([email protected])
Elise M Rasmussen
A Novel Approach to Improving Automated Bacteriophage Genome
Annotation Utilizing Machine Learning
Elise M Rasmussen, Steven G Cresawn
Genome annotation tools such as Glimmer and GeneMark use sophisticated mathematical techniques to
model the characteristics of genes, however the quality of these models is fixed from the point at which they
are created. They fail to adapt to newly available genome sequences or the refinements in annotations
provided by expert human reviewers.
In contrast machine learning utilizes algorithms and statistical modeling to solve problems by relying on
learned patterns. It has emerging applications in numerous fields including bioinformatics. Machine learning
can be supervised or unsupervised. In supervised machine learning a subject area expert guides the algorithm
to the appropriate conclusions. Supervised machine learning is divided into two major processes: regression
and classification. Regression is used to predict a continuous output from a given input. Classification predicts
the category the data belongs to based on the provided input parameters. It is utilized for predicting discrete
responses and was selected over regression as the more appropriate method for gene prediction. After
developing a model to predict genes, the model was then compared to expert human-generated annotations
or those produced by hidden Markov modeling-based approaches such as Glimmer or GeneMark.
A neural network was created using the TensorFlow machine learning toolkit and the Python programming
language. Input parameters for the model included gene length, direction, direction of upstream and
downstream genes, distance to the preceding upstream stop codon, and a frequency table of dinucleotides
within the coding sequence. The model was trained using nearly all SEA-PHAGES quality-controlled, protein-
coding genes from phages that infect Actinobacteria.
53
11th Annual SEA Symposium Abstract
James Madison University
Harrisonburg VA
Corresponding Faculty Member: Louise Temple ([email protected])
Louise Temple
Give Them An Inch And They’ll Take A Mile: Creative Phage Projects
Louise Temple, Stephanie Stockwell
Calling all phage groupies! Want to play a phage board game? Work a puzzle? Listen to rap or song with unique
lyrics? Read a children’s book? Stand in awe of amazing poetry? Just ask your students to create something—
anything creative, really—about their own experiences with discovery and analysis of phages. “I could never
think of anything,” they often say, when I announce this assignment. And yet, semester after semester, clever,
unique, surprising contributions are presented to classmate and added to my growing collection of Phantastic
Phun Phage Art. A number of items will be displayed at the symposium for your enjoyment and amazement.
54
11th Annual SEA Symposium Abstract
Johns Hopkins University
Baltimore MD
Corresponding Faculty Member: Emily Fisher ([email protected])
Sruthi Katakam
Microbacteriophages ChickenKing and Benjalauren share synteny but low
homology in the the EA cluster
Sruthi Katakam, Lucas Polack, Benjamin Fry, JHU PhageHunters, Emily J Fisher
PhagesDB currently lists 1474 pages isolated on M. foliorum, 177 of which have been sequenced. Of those, 88
are in the EA cluster. This year, students at Johns Hopkins University discovered and annotated the genome of
ChickenKing, a siphoviridae that defines a new subcluster, EA9. The most closely-related genome is that of
Schubert, a cluster EA8 page discovered in 2017 at the University of Pittsburgh. Though other EA genomes are
not identical in terms of sequence homology, they share most genes and 41/57 genes in ChickenKing are
shared in the EA1 genome of Benjalauren, another phage isolated at JHU this year. Like other EA cluster
phages, ChickenKing and Benjalauren are lytic and their genomes lack an integrase gene. They also both have
two-part tail assembly chaperone genes and we were unable to identify a programmed frameshift that would
unite them into one gene. We present comparisons of EA1, EA8, and EA9 genomes and discuss approaches to
calling genes in a new subcluster in which Starterator and Phamerator sometimes lack information.
55
11th Annual SEA Symposium Abstract
Kansas State University
Manhattan KS
Corresponding Faculty Member: Christopher Herren ([email protected])
Flint Hills Phages - Characterization of Microbacterium foliorum cluster EB
& Gordonia terrae clusters CZ, CV, and subcluster CY1 Bacteriophages
Jordan R Block, Andrew M Braun, Jacob M Darsow, Nollan G Dillavou, Benjamin L Engle, Isaac D Fitz, Samuel E
Forbes, Shay E Geear, Isaac M Gutsch, Megan N Johnson, Camryn D Lopez, Tony F Ngassi, Paige E Poolman,
Camryn G Splichal, Arendje Takata, Drake A Vanbuhler, Lauren M West, Megan A Willmon, Martha Smith
Caldas, Christopher D Herren
For three years, Kansas State University has been isolating mycobacteriophages from enriched soil samples in
Mycobacterium smegmatis. This year’s project expanded our host range to include Microbacterium foliorum
NRRL B-24224 SEA and Gordonia terrae CAG3. Our first semester yielded a 100% isolation rate, with 22
students isolating two M. foliorum and 20 G. terrae phages. Of the four genomes sequenced and annotated,
one was a M. foliorum phage and three were G. terrae phages. BubbaBear, an EB cluster M. foliorum phage, is
a small (69 genes), lytic phage that replicates with a particularly large plaque morphology. Included in its
relatively small genome are 5 genes associated with thymidine metabolism, including thymidylate kinase,
thymidylate synthase, dUTP pyrophosphatase, dihydrofolate reductase and thioredoxin. Four of the five genes
in this pathway are found in all 18 EB cluster members, while the 5th gene, dUTP pyrophosphatase, is found in
17 of the 18 members. EnalisNailo is an average-sized temperate CY1 subcluster G. terrae phage. It has 66
genes, including two putative Y-integrase genes adjacent to each other in the genome. Five other of the eight
CY1 subcluster phages also have this double, adjacent Y-integrase gene arrangement. Temperate phages
customarily have a single integrase gene to establish lysogeny, so the conserved presence of two complete
integrase genes adjacent to each other, but in separate pham groups in the CY1 subcluster, is of interest.
Faith5x5 is a temperate G. terrae phage in the CZ cluster, but does not classify further into any of the seven
known subclusters. This cluster and its subcluster are sparsely populated with mostly draft genomes. The CZ
cluster, subclusters excluded, has only two members and the members are very divergent in gene content on
both arms of the genome. Unlike some members of the cluster, Faith5x5 has a single holin A gene instead of a
2-gene holin A coding arrangement seen in other CZ cluster genomes. Wocket is a CV cluster temperate G.
terrae phage with 79 genes. Included in the genome are two lysin A genes corresponding to the amidase
and
C39 peptidase domains. While prove
n to be tem
perate by lysogeny assays, excise was not able to be identified
in the genome, while S-integras
e, immunity repressor, and a CRO/HTH DNA binding domain were putatively
identified by sequence analyses.
56
11th Annual SEA Symposium Abstract
La Salle University
Philadelphia PA
Corresponding Faculty Member: Jason Diaz ([email protected])
Mary C Yan
Investigating the Programmed Frameshift in Buttons Gene 22
Mary C Yan, Sean McClory, Jason Diaz
In ISBT 104, my class annotated our adopted mycobacterium phage, Buttons. The Mycobacterium phage
Buttons was discovered by Christina Jodway in Milbridge, Maine as part of the SEA-PHAGES program. This
particular phage was isolated from the bacterial species Mycobacterium smegmatis and its genome was
sequenced. Buttons is classified in the subcluster A1. This phage genome length is 49,420 base pairs long.
There are 86 genes in Buttons. The predicted life cycle for Buttons is the lysogenic life cycle. Buttons has a
“slippery” sequence in gene 22 where the ribosome makes a mistake and changes the reading frame during
translation. This causes the ribosome to make a longer protein in Buttons where the first half is approximately
aligned to the short-form of the gene but the rest of the sequence is different. Programmed translational
frameshifting (PTF) is an alternate process in protein translation. PTF usually happens in the tail-assembly
chaperone proteins. The tail-assembly chaperone protein comes in two forms of the small subunit and the
large subunit. In genes 22 and 23 of Buttons, gene 22 encodes the small subunit of the tail-assembly
chaperone protein, and PTF causes fusion of genes 22 and 23 to create the large subunit. PTF is one way
phages can regulate protein levels without the use of a new promoter. Overall, PTF helps the phage maintain
the correct proportion of chaperone proteins to efficiently assemble the tail fiber for Buttons.
57
11th Annual SEA Symposium Abstract
La Sierra University
Riverside CA
Corresponding Faculty Member: Natasha Dean ([email protected])
Uylae Kim
Isolation and analysis of two Gordonia phages, CherryonLim and
OhMyWard
Uylae Kim, Bryn Batin, Emily Choi, Jasleen Dharni, Sydney Figueroa, Sunil Kim, Loren Klim, Yun Seok Lee, Diana
Lim, Axel Nathaniel, Chung Chun Shih, Kristen Simental, Elizabeth Suh, Roshni Trivedi, Isabela Valladolid,
Corrine Wang, Cassandra Ward, Keina Yoo, Jessica Choi, Natasha Dean, Arun Muthiah, Arturo Diaz
Students from La Sierra University isolated nineteen bacteriophages from several locations near Riverside, CA
either through enrichment culture or direct plating. Fifteen of the phages were isolated from Microbacterium
foliorum, and four from Gordonia rubripertincta.
Host range assays were performed on seven bacteriophages based on the results of preliminary experiments.
The efficiency of plating was calculated for four related species of Microbacterium and two species of
Gordonia. Plaquing efficiencies at different growth temperatures (25°C, 30°C, and 37°C) were also measured
for each phage.
We selected two lytic Gordonia phages, CherryonLim and OhMyWard, for further investigation. Morphological
analysis showed that both phages belong to the family Siphoviridae, which is characterized by a non-enveloped
head, double-stranded DNA, and a non-contractile tail. Illumina sequencing was used to assign CherryonLim
and OhMyWard into clusters CT and DJ, respectively. DNA Master and PECAAN were used to annotate each
genome by assigning gene functions to putative ORFs.
CherryonLim is 48,948 base pairs long with 72 genes, making it the largest phage in its cluster. It also has a GC-
content of 60.2%, and a 3’ single-strand extension of 13 bases. Phages in cluster CT are not known to have
tRNAs and this is true for CherryonLim. OhMyWard has a genome length of 60,978 base pairs with 85 genes
that are all in the forward direction, a GC-content of 52.2% and a 3’ single-strand extension of 9 bases. It is
similar to other phages in cluster DJ, but interestingly it has the greatest number of orphams.
58
11th Annual SEA Symposium Abstract
Lafayette College
Easton PA
Corresponding Faculty Member: Bob Kurt ([email protected])
Maria Padilla
PauloDiaboli from Lafayette College: Examining Genes 170, Ribonucleotide
reductase R2-1 small subunit, and 174 ,Ribonucleotide reductase 2.
Maria Padilla, Abigail Esposito, Austin Best, Manuel Ospina-Giraldo, Robert Kurt
Microbacterium phage, PauloDiaboli, was discovered by utilizing the method of direct isolation. PauloDiaboli
was found from a soil sample collected at Lafayette College, Easton PA. The idea for the name arose from the
tiny plaques the phage consistently generated, leading to multiple titrations until appropriate-sized plaques
were displayed. There was a point in which we thought the phage stock was no longer viable, and due to the
phage’s stubbornness, the Latin meaning of “little devil” inspired us to name him PauloDiaboli. With a genome
composed of 191968 base pairs and with a GC content of 60.09%, we decided to examine PauloDiaboli’s genes
170 and 174. Uniquely enough, PauloDiaboli was identified as a singleton phage. However, we were able to
find similarities among gene function in PauloDiaboli’s genetic makeup. Setting a focus on protein folding led
us to place our attention on the influence that alpha helices and beta strands have in the protein sequence
that contributes to the genetic makeup of PauloDiaboli. Utilizing UnitProt and HHPred, we studied the specific
roles of the active site and metal binding site of both of these structures in PauloDiaboli. While the active site
aids in generating GDP, essential for energy supply, the presence of the metal binding site facilitates mineral
absorption by the host. How is protein folding such an essential aspect to consider in a singleton phage? Since
acquiring and storing energy is facilitated in phages, we concluded that the concentration of both of these
protein structures are required to enable phages similar to PauloDiaboli to thrive in diverse environments.
59
11thAnnualSEASymposiumAbstract
LehighUniversity
BethlehemPA
CorrespondingFacultyMember:VassieWare([email protected])
CaitlinMurphy
GraceCiabattoni
ExploringaSEAofPhages:NewInsightsintoPhageGenomeDiversity,
Host‐PhageInteractions,andImmunityRelationships
CaitlinMurphy,GraceCiabattoni,NicholasDesGranges,LonghuiGao,BriannaGipson,KatherineVolpe,
MatthewGreen,MarikaLivingston,JourneyLopez,HansenLukman,RyanMatthiessen,PaigeMcCloskey,
BriellePaul,HannahSchuster,JamieKorenberg,NettaCudkevich,CatherineMageeney,HamiduMohammed,
MargaretKenna,VassieWare
Lehigh’sSEA‐PHAGESprogramprovidesacontinuumofcollaborativeresearchopportunitiesforfirstyearand
advancedundergraduateswhofocusonisolatingandcharacterizingActinobacterphagestogainabetter
understandingofphagegenomestructuraldiversity,genefunction,andphagebiologyingeneral.Additionally,
ourgrouphasinvestigatedimmunitymechanismsthatprotectClusterNlysogensfromattackbyheterotypic
phages.Prophage‐mediatedimmunity,conferredbyClusterNMycobacteriumphageButters,hasbeenthe
primaryfocusofourstudiestounderstandmechanismsthatdifferentiallyprotectaButterslysogenfrom
infectionbyClusterA3phagePurpleHazeandClusterI1phageIsland3.Herewereportonprogressonseveral
projects.I.Inadditiontouncovering12newphagesinfectingMycobacteriumsmegmatisincludingtwonew
ClusterNphages,SmurphandShrimpFriedEgg,wetestedalldirectsamplesonanadditionalhost,
Microbacteriumnatoriense.MicrobacteriumphageTheresitawasisolated.II.Anestimateofclusterdiversity
wasobtainedfromDOGEMSanalysisandthreenewmycobacteriophagegenomeswereannotated(two
ClusterNphages[Smurph,ShrimpFriedEgg]andClusterA11phageOrange).Studentsalsofocusedontesting
infectivityofnewlyisolatedM.smegmatisphagesonClusterNXenolysogenlawns,anddiscoveredone
ClusterA11phage(Orange)withreducedinfectivitycomparedtoinfectivityonM.smegmatislawns.Immunity
60
experimentsbetweenClusterNandA11phagesisolatedfrompastXenoexperiments(Bud,Bowtie,Munch)
continue.III.AnnotationofMicrobacteriumphageTheresita(SubclusterEA7)revealedachimericgenome
organizationwithleftarmnucleotideconservationwithClusterEAphagesandrightarmnucleotidesimilarity
withClusterEJphages.IV.WehavepreviouslyshownthatButtersgp30isrequiredfordefenseagainst
PurpleHazeinfection.ThisrequirementformediatingdefenseagainstPurpleHazeinfectionwasfurther
supportedbycomparativeimmunityanalysesusingseveralM.smegmatisstrains,lackingorexpressinggp30.
ToinvestigatethemechanismofButtersprophage‐mediateddefense,defenseescapemutants(DEMs)for
PurpleHazeandIsland3wereisolatedandgenomessequenced.PurpleHazeDEMSmutationsmappedto
genesencodingminortailproteins.Interestingly,recoveryandsequencingofIsland3DEMSrevealedthe
presenceofhybridphagesgeneratedbyrecombinationbetweenButtersandIsland3phagegenomeswhere
significanthomologyexists.Lysogensfromhybridphages,referredtoasBIBphages(Butters‐Island3‐Butters),
arecurrentlybeinggeneratedforadditionalimmunitystudies.Collectively,thisarrayofinvestigations
highlightsongoingresearchundertakenbyLehigh’sSEA‐PHAGESstudentstobroadenourunderstandingof
phage‐hostinteractionsandphagegeneexpression.
61
11thAnnualSEASymposiumAbstract
LeTourneauUniversity
LongviewTX
CorrespondingFacultyMember:GregFrederick(GregFrederick@letu.edu)
ChristinaESpencer
KatelynGutierrez
IdentificationandImplicationsofSoil‐DwellingBacterialDNA
MethyltransferasehomologsinMycobacteriumPhagePhalm
ChristinaESpencer,KatelynGutierrez,FrederickNBaliraine,GregoryDFrederick
GenomeannotationofthetemperatephagePhalmrevealedtwogeneswithhomologyto
methylase/methyltransferase(MTases)genesinotherbacteriophages,aswellasinvarioussoil‐dwelling
bacteria.MTasesareenzymesthatmethylatespecificbasesinnucleicacids.Inbacteria,MTasesareknownto
beimportanttocellsurvivalandotheraspectsofnucleicacidmetabolism.MTasesalsofunctioninepigenetic
regulatoryprocesses.Further,MTasesfunctioninrestriction‐modificationsystems.Forpropercellfunction,
nucleicacidmodificationisessentialindirectingthemonitoringofthegenomebyothercellularenzymes.
AlthoughthefunctionsofbacterialMTasesarewellknown,theexactfunctionsofMTasesinbacteriophage
genomesremainunelucidated.
InphagePhalmandothermembersoftheP1subcluster,suchasBrusacoramandShipwreck,MTasesgenes
arelocatednexttoproteinsofunknownfunction.Similarly,inM.abscessussubsp.bolletiistrain107,MTase
genesaresurroundedbyhypotheticalproteins.Notably,withintwoorthreegenesoneithersideoftheMTase
genesinPhalmandothersubclusterP1phagesliesageneencodinganendonucleaseorahelix‐turn‐helixDNA
bindingdomainprotein.Moreover,oneofthehypotheticalproteinsinM.abscessusishomologoustogene51
ofphagePhalm,andinthisregionsyntenyisverysimilar.ItishypothesizedthatMTasesaremostlikely
involvedinprotectingthephagegenomesinsidetheirbacterialhosts.Specifically,MTasesmostlikelyprotect
thephagegenomefromrestrictionbyhostenzymes.PreviousinvestigationsindicatethatMTasesare
necessaryforstablelysogeny.Characterizationofphage‐encodedMTasescouldhaverelevanceinhost‐range
determination.NCBIBLASTpanalysisofPhalmgp53and55alignwithhomologsinmultiplesoil‐dwelling
bacteria.ThesebacteriaincludeMycobacteriumsp.UM_RHS,M.abscessus,M.salmoniphilum,M.chelonae,
62
M.fortuitum,andRhodococcus.Phalmgp53and55alignedwithdifferentsite‐specificMTasegenesinM.
abscessus.ThepresenceoftwoMTaseshomologoustoslightlydifferentbacterialproteinsimpliesthatphage
Phalminhabitedbacterialspeciespossessingmorethanonerestrictionsystem.Theacquisitionand
preservationofmultipleMTasegeneswouldprotectsubsequentgenerations.
MTasesgenesinclustersN,AY,O,andAQwerealsoexamined.TheMTasegenesinthesephagesalsoshowed
homologytomultiplebacterialMTases.ThesegeneproductsshowedhomologytobacterialMTases,
specificallythoseofthesamegenusasthehostspeciesusedinisolation.
Thisstudydescribesapplicationofmultiplebioinformaticstools,includingPhamerator,NCBIBlastP,HHPred,
andSplitstree,toelucidateplausiblerolesandsignificanceofMTasegenesinbacteriophagegenomes.
63
11th Annual SEA Symposium Abstract
Merrimack College
North Andover MA
Corresponding Faculty Member: Janine LeBlanc-Straceski ([email protected])
Morgan Murray
You Are One in a Minion(Dave): A Comparison of F1 Cluster
Bacteriophages
Morgan Murray, Madison Carney, Annmarie Schmid, Charlotte Berkes, Janine LeBlanc-Straceski
MinionDave, Piper2020, and Cornucopia are three Mycobacterium smegmatis bacteriophages of the
Siphoviridae morphology found in the F1 cluster. In Spring 2019, students at Merrimack College annotated the
genome of MinionDave, which was isolated from Cathedral Caverns State park near the Mystic River in
Alabama by a student at Jacksonville State University in 2013. Two other F1 cluster phage, Cornucopia and
Piper2020, were isolated, characterized and annotated at Merrimack College. A comparative analysis of the
genomes of MinionDave (58027 bp), Piper2020 (57703 bp) and Cornucopia (55422 bp) was performed.
MinionDave is homologous with both Piper2020 and Cornucopia in the first half of the genome beginning at
approximately 7000 bp, while Piper2020 and Cornucopia are homologous throughout this region. Divergence
in genome structure at the 5’ end is consistent with a previous analysis of the F1 cluster (Hatfull, et al.J Mol
Biol. 2010 Mar 19; 397(1): 119–143.). Further investigation shows that the first 8 genes of MinionDave are
found in a subset of bacteriophage in the F1 cluster such as CaptainTrips, MilleniumForce, and KristaRAM.
MinionDave and Cornucopia have Y integrase genes belonging to Pham45734, whereas Piper2020 contains a Y
integrase in Pham44984. These are the only two integrases present in the F1 cluster, although they are
represented in a subset of other clusters as well (Pope et al. 2011. PLoS ONE 6(10): e26750.
doi:10.1371/journal.pone.0026750.). We have observed that Piper2020 generates clear plaques and
Cornucopia generates cloudy plaques consistent with lysogeny. Therefore we predict that MinionDave would
also be a temperate phage based on the similarity of its integrase to Cornucopia. BLAST comparison showed
MinionDave and Cornucopia’s integrases were 91% similar. All three phage have different DNA methylase
genes belonging to four different Phams. Piper2020 has two long DNA methylase genes (1518 bp and 2520 bp,
respectively) but Cornucopia and MinionDave each have only one medium sized DNA methylase (951 bp and
1302 bp, respectively). In addition, MinionDave and Cornucopia have 105 genes, but while their genomes are
roughly the same size they differ by about 3000 base pairs in length. Based on the comparisons of Cornucopia,
Piper2020, and MinionDave a more in depth understanding can be reached regarding the function of F1
clusters and their relationship to Mycobacterium smegmatis.
64
11th Annual SEA Symposium Abstract
Miami University
Oxford OH
Corresponding Faculty Member: Mitchell Balish ([email protected])
Hope A Kirby
Two new Microbacterium foliorum bacteriophages, Belthelas (EE) and
Lupine (ED1)
Hope A Kirby, Natalie L Hanson, Leah R Watson, Hannah R Wilson, Meili A Aiello, Faith L DeVengencie, Rocco A
Huston, Avery M Imes, Halie M Leftwich, Maeve E Proto-Newton, Brandon E Romell, Maria R Schlegel, Maddy
D Spencer, Sydney Arlis, Garrett M Schilling, Elizabeth Lucas, Mariah S Squire, Kelly Z Abshire, Rebecca S Balish,
Mitchell F Balish
In Miami University's first efforts at discovering phages that infect Microbacterium foliorum, 10 students out of
20 successfully isolated phages from samples of soil and leafy organisms. All 10 phages had morphology typical
of Siphoviridae. Two lytic phages, Belthelas and Lupine, were submitted for genome sequencing and subjected
to annotation. In agreement with predictions from DNA analysis, Belthelas was found to be a cluster EE phage
with a typical small genome of 17,502 bp and 25 predicted genes. The gene content, more or less identical to
most other cluster EE phages, confirms the low diversity within this phylogenetic cluster, which is well-
represented in the Actinobacteriophage Database. Lupine, in contrast, was a member of the much less
commonly described subcluster ED1, with a genome of 62,533 bp. Preliminary annotation suggests
approximately 110 genes plus 7 present in a second copy on the 3,260-bp terminal repeat region of the
linearized genome. Analysis of these genes suggests substantial diversity within subcluster ED1, with an
assortment of genes not assigned to any pham and some others that, although assigned to phams, have no
BLAST hits above the threshold of significance. None of these novel genes could be assigned likely functions.
We conclude that whereas the phages of cluster EE, frequently encountered and bearing low diversity, have
arrived at a highly successful strategy for propagation, the highly diverse phages of subcluster ED1 are rather
dynamic in terms of evolution.
65
11thAnnualSEASymposiumAbstract
MinnesotaStateUniversityMoorhead
MoorheadMN
CorrespondingFacultyMember:SumaliPandey(sumali.pandey@mnstate.edu)
KelseyLeach
IsolationandCharacterizationofMicrobacteriumphageEttaand
DiscoveryofBacteriophageVersUsingaNovelAntarcticCryobacterium
Isolate
AnnaMadsen,KelseyLeach,MadelynMadsen,SumaliPandey,MichelleTigges
Bacteriophagesaresomeofthemostprolificanddiversebeingsontheplanet,however,comparativelylittleis
knownabouttheirdiversity.Theaimofthisprojectwastounderstandthediversityandcharacteristicsof
phagesthatinfectmembersoftheMicrobacteriaceaefamilyofActinobacteria.Thisfamilyincludesbacteria
commontoterrestrialplantandsoilenvironments,suchasMicrobacteriumfolorium,aswellaspsychrophilic
bacteriacommontoglacialenvironments,suchasCryobacterium.Soilsampleswerecollectedfrom
(46.866729N,96.75782W),anddirectisolationonM.foloriumwasusedtoidentifyaclusterEA1phage,Etta.
EttaisalyticphagefromtheEAclusterandtheEA1subcluster.Itisasiphoviridaewithsmallroundplaques
withlowtomoderateturbidity.Ettahasagenomethatis41542bp,with63.3%GCcontent,andisclosely
relatedtophagesGelo(99%identity)andCalix(99%identity).ToextendouranalysisofMicrobacteriaceae
phagediversity,wedevelopedmethodsallowingfortheisolationofaphagethroughtheinfectionofanovel
AntarcticpsychrophilicCryobacteriumisolatedfromasupraglacialstream.Waterwascollectedfrom
(44.872171N,91.938466W)andtraditionalphageisolationmethodsweremodifiedtocreateaprotocol
whichwouldallowforthediscoveryofphagesat4°C,leadingtotheisolationofbacteriophageVers.
Interestingly,Versisaphagewiththeabilitytoinfectmultiplebacteriainacoldenvironmentandcanbe
propagatedat4°CusingbothMicrobacteriumfolioriumandCryobacteriumisolateasahost.Thisexperiment
providesinsightintothediversityofphagesandhowcharacteristicsandgeneticsvaryinphagesisolatedfrom
differentenvironmentsandhosts.
66
11th Annual SEA Symposium Abstract
Mitchell Community College
Statesville NC
Corresponding Faculty Member: Parks Collins ([email protected])
Thomas Ray
LaviMo: Isolation, DNA Analysis, and Comparative Genomics
Thomas Ray, Ryan Kistemaker, Alyssa Moliis
As part of the HHMI SEA-PHAGES program, over 200 Microbacteriophages have been identified, sequenced
and classified into clusters. Mitchell Community College in Statesville, NC just completed its first year as part
of the HHMI SEA-PHAGES program. In the fall semester, students isolated seven bacteriophages from soil
samples. The phage LaviMo was chosen to be sequenced. LaviMo was isolated through direct isolation.
Electron microscopy and molecular characterization indicated that LaviMo belonged to Siphoviridae. DNA from
LaviMo was isolated and the complete genome was sequenced during the spring semester. Auto-annotation
through DNA Master revealed twenty-six open reading frames. Based on average nucleotide identity, LaviMo is
classified as a cluster EE microbacteriophage with a 99% sequence identity to phages Scamander and
BurtonThePup. Here we present the initial data from the annotation of this new cluster EE phage. This
research expands the diversity among cluster EE phages and provides an insight to the evolutionary
characteristics of microbacteriophages.
67
11th Annual SEA Symposium Abstract
Monmouth College
Monmouth IL
Corresponding Faculty Member: James Godde ([email protected])
Sarah A Poirier
Isolation and Genomic Annotation of Novel Microbacterium Phages: Is the
EC Cluster Losing Its Tail Assembly Chaperone Slippery Sequence?
Brendan G Guenther, Ashley N Long, Piper N Miller, Jordan M Peckham, Sarah A Poirier, Eric M Engstrom,
James S Godde, Timothy J Tibbetts
In 2018 Monmouth College joined SEA-PHAGES (Cohort 11). To contribute to expanding the number and
diversity of well-characterized phage genomes, we are working to isolate novel Microbacterium foliorum
bacteriophages. One phage we discovered, PiperSansNom, is a novel member of the EC cluster. In evaluating
the tail assembly chaperone translational frameshift “slippery” sequence of PiperSansNom, we concluded that
this phage lacked a slippery sequence. However, we noted that a minority of EC phages exhibit annotated
slippery sequences, specifically CCCCCCTA. In all other Microbacterium clusters, either all cluster members
exhibit annotated slippery sequences, or all clusters lack these sequences. We performed phylogenetic
analysis on the first (universally transcribed) EC tail assembly chaperone genes. Relationships of these genes
suggest a loss of slippery sequences within the EC cluster.
68
11th Annual SEA Symposium Abstract
Montana Tech of the University of Montana
Butte MT
Corresponding Faculty Member: Marisa Pedulla ([email protected])
Winter R Kemppainen
Investigation of 23 different Mycobacterium smegmatis lysogen strains
Winter R Kemppainen, Riley D Hellinger, Joel W Graff
Twenty-three Mycobacterium smegmatis lysogen strains were created and grown using phages from 2018
SEAPHAGES laboratories. The bacterial cells and colonies of lysogenic and wildtype bacteria were visualized
using Acid-Fast staining and colony growth on 7H10+++ agar plates. Each lysogen and the wildtype M.
smegmatis were grown on 7H10+++ agar plates at 26°C, 30°C, 37°C, 42°C, and 50°C for 7 days. The plates were
examined once per day.Lysogenic and wildtype M. smegmatis culture samples were treated with EtBr
(2μg/mL) at 8 hrs., 16 hrs., and 24 hrs. of growth. The cells were visualized at 400x magnification with
fluorescence microscopy. Three lysogen strains and wildtype were cultured in different 7H9 media of different
CaCl2 and glycerol concentrations. OD readings were taken over 3 days of culture growth. Among the lysogen
strains, differences in colony morphologies and growth rates were observed.
69
11th Annual SEA Symposium Abstract
Montclair State University
Montclair NJ
Corresponding Faculty Member: Sandra Adams ([email protected])
Ashley S Peralta
Isolation and Characterization of Novel Arthrobacter sp. and
Mycobacterium smegmatis Bacteriophage from New Jersey Soil
Ashley S Peralta
The goal of this study was to isolate and characterize novel bacteriophages from New Jersey soil samples that
infect Arthrobacter sp. and Mycobacterium smegmatis. Soil samples were collected from diverse locations in
northern New Jersey. Bacteriophage infecting Arthrobacter sp. and M. smegmatis were successfully isolated
from enriched soil samples that were screened for their ability to form plaques on separate lawns of both
species of bacteria. DNA was extracted from high titer lysates. Of the phages isolated in 2018, one M.
smegmatis phage (Gator) and one Arthrobacter sp. phage (Linus) were sequenced and annotated in 2019.
Gator is a cluster E temperate phage with a putative 133 genes (including two tRNA genes). Gator is the first
temperate phage to be isolated at MSU as part of the SEA-PHAGES genomics course. Linus is a cluster AR lytic
phage with a putative 109 genes. Like other AR phages, all but five of Linus’s 109 genes are transcribed using
the top strand of DNA, with the five genes transcribed from the bottom strand surrounded by forward genes.
70
11th Annual SEA Symposium Abstract
Mount Saint Mary College
Newburgh NY
Corresponding Faculty Member: Suparna Bhalla ([email protected])
Eleanora G Robinson
The Journey Continues: Annotation of three novel Microbacteriophages
Stanktossa, DirtyBubble and Roman
Eleanora G Robinson, Suparna Bhalla, Evan Merkhofer
In 2017-2018 the Mount Saint Mary College Phage Hunters transitioned to the host Microbacterium foliorum
for the isolation on novel bacteriophages in an attempt to provide more insight into the diversity of genomes
across the Actinobacteriophage phylum. This year, fifteen Microbacteriophages were isolated from soil
samples gathered in Newburgh, NY. Phages Stanktossa and DirtyBubble were obtained through enriched
isolation, both yielding small, cloudy plaques after 48 hours of incubation at 30C while Roman was obtained
as a result of a direct isolation, yielding large, clear plaques after 24 hours at 30C. TEM analysis revealed that
all three phages have the Siphoviridae morphotype. Sequencing of Stanktossa (circularly permutated, 41.8 kB
length, 63.6% GC content), DirtyBubble (linear with 3’ sticky overhang, 41.6 kB length, 68.7% GC content) and
Roman (linear with direct terminal repeat, 64.2 kB length, 62.8% GC content) identified them as members of
the EA1, EB, and ED1 subclusters, respectively. All three phages were predicted to have a lytic life cycle based
on the initial analysis of the genome sequences. Successful annotation of these novel phages was a collective
effort between several students and faculty using bioinformatic programs including PECAAN, GeneMark,
Phamerator and Starterator. Gene functions were assigned using the HHpred and NCBI BLAST programs. In
addition, we are performing phylogenetic analysis of the three bacteriophages to determine their evolutionary
relationship. We are also characterizing the phage Goldina, which currently exists as a mixed sample with
Roman. Using genomic FASTA files from both Goldina and Roman, we are using phage-specific primers and PCR
to make separate pure titers of the two phages. Upon successful separation, the Goldina genome will be
annotated.
71
11th Annual SEA Symposium Abstract
Neumann University
Aston PA
Corresponding Faculty Member: Matthew Mastropaolo ([email protected])
Christopher J Negro
An Expedition in the Leaves, the Characterization and Annotation of
Microbacterium Phage Hiddenleaf.
Christopher J Negro, Daekwon M Sequira, Megan Bates, Christian Bjorkelo, Trang Doan, Hailey A Johnson,
Nafees Norris, Emily Sasher, Ian M Sigmund-Hamre, Courtney L Womack, Christina T Zacconi, Lauren R Salvitti,
Patricia Fallest-Strobl, Matthew D Mastropaolo
In the 2018-2019 academic year eleven students at Neumann University collected soil and water samples from
Delaware County, PA. Microbacterium foliorum NRRL B-24224 SEA was used as the host to isolate 10
bacteriophage as part of the first cohort of SEA-PHAGES students. Hiddenleaf was isolated and purified from a
soil sample at the base of a garden bird bath under some chive plants. The phage was separated using
standard procedures to isolate a genetically unique phage sample and amplified. DNA extraction and
sequencing were performed. Analysis of the genome classified Hiddenleaf as Siphoviridae morphology in the
EF cluster, which currently has 7 total members, 6 of which are currently annotated. Hiddenleaf has 84 genes
and a genome length of 56082 bp, which is the smallest genome of the EF cluster. Seven orphams were
identified in the genome. The genome was annotated using PECAAN, NCBI BlastP, HHPred and a comparative
analysis was done using phagesdb.org and phamerator.org.
72
11th Annual SEA Symposium Abstract
North Carolina A&T State University
Greensboro NC
Corresponding Faculty Member: Roy Coomans ([email protected])
Anjali Kumari
Bacteriophages Marteena and Nubi: Distinct Clusters United by Shared
Phams
Anjali Kumari, Ria Holloman, Olufemi Olatidoye, Rachel Richards, Jewel Washington, Correggio Peagler, Lia
Artis, Lauren Thompson, Abeku Abercrombie, Lindsey Adams, Kevin Frazier, Najee' Green, Roy Coomans
Bacteriophages are viruses that replicate within a bacterial host. Due to their size and mode of replication,
phages are far more abundant than bacteria or any other organism. We isolated six bacteriophages of
Gordonia terrae CAG3 in the fall of 2018. DNA extracted from one of these, Marteena, was submitted to the
Pittsburgh Bacteriophage Institute for sequencing. Marteena was isolated from soil collected on the campus
of North Carolina A&T State University. Marteena is in subcluster CY1. Its genome is 50531 base pairs in length
with a 66.6% GC content. Through isolation, purification, and computational analysis, we were able to
articulate the similarities and differences between Marteena and Nubi, a second bacteriophage of Gordonia
terrae isolated at N. C. A&T in the fall of 2017. Nubi, a cluster DC phage, has a genome length of 58718 base
pairs and a 67.9% GC content. Nubi and Marteena exhibit a temperate life cycle. Some host cells are lysed
following infection, releasing newly replicated phage particles, while other host cells become lysogens. Our
research involved two major activities, isolation of the phage and annotation of the genome. The initial
process of isolation was accomplished through enriched isolation and amplification of the phage particles
using serial dilutions. DNA Master, GeneMark, HHPred, NCBI BLAST, phagesdb, Phamerator, I-TASSER, SEA-
PHAGES.org, and PECAAN were employed to annotate, compare, and hypothesize on the function of genes
and origin of differences present in the two phages. Phylogenetic trees generated from single gene
comparisons allowed us to evaluate the placement of Nubi and Marteena into clusters and sub-clusters. BLAST
revealed that Nubi and Marteena contain genes similar to those found in a variety of different bacteria. Could
this be due to the evolutionary advantage of producing these bacterial proteins, or is it a result of phages
assimilating their DNA into the bacterial DNA to hijack replication and produce more phage particles? Even
though phages might have a negative reputation, they can also be beneficial through manipulation and utilized
to cure lethal bacterial infections. The research, in collaboration with the SEA-PHAGES Program, allows
undergraduate students to articulate information through analysis and hypothesize new information.
73
11th Annual SEA Symposium Abstract
Northwestern College
Orange City IA
Corresponding Faculty Member: Sara Tolsma ([email protected])
Kristina M Sevcik
Investigating Our Phage-Filled World: Discovery, Annotation, and
Antibodies
Kristina M Sevcik, Byron Noordewier, Sara S Tolsma
Six bacteriophages previously isolated at Northwestern College using Mycobacterium smegmatis mc2155 as
host were sequenced: DrLupo, JacoRen57, Beelzebub, and RedRaider77 using RFLP-directed DOGEMS and
Antonia and Raela individually. We annotated all six mycobacteriophage genomes. In addition, we isolated
eight phages with Microbacterium foliorum as host and one phage with Gordonia terrae as host. These have
yet to be sequenced. Our annotation efforts focused on the six discovered phages and four adopted phages:
Chelms, Laila, Phineas and Cracklewink. All annotated phages are siphoviridae in morphology with only Phineas
and Cracklewink being temperate. Collectively they represent eight different clusters. Antonia was typical of
the abundant cluster B1 phages. DrLupo is related to Barnyard, the other cluster H2 phage. It has a non-
canonical frameshift in its tail assembly chaperone gene, several orphams, and a low GC content of 57.5%.
JacoRen57 is a singleton, most closely related to the AB cluster phages FF47 and Muddy. Its long tape measure
gene is an orpham, there are numerous orphams with unknown functions in the right arm of the phage, and its
GC content is low (56.7%). Since FF47 and Muddy can infect Mycobacterium abscessus, the Hatfull lab is
working to see if JacoRen57 can also infect related hosts. Beelzebub, Raela, and RedRaider77 are cluster S
phages. All three contain minor tail protein genes in their right arm as do other cluster S phages and previously
confirmed in phage Marvin. Phineas resembled other P1 phages—especially Shipwreck and Fishburne.
Cracklewink is more closely related to Bipper than Typha, the other two cluster Y members, especially in the
right arm of the genome. It has one tRNA gene and some interesting large gaps that lack coding potential.
Chelms is a cluster CS Gordonia phage. It is typical of cluster CS phages with a two-part lysin A gene (N-
acetylmuramoyl-L-alanine amidase domain followed by the protease domain) and a lysin B 15 genes
downstream of the two-part lysin A. It contains both forward and reverse genes and a single tRNA gene. Laila is
cluster AN Arthrobacter phage. At 15,556 bp, it was the smallest of our phages. Laila exhibits synteny typical of
cluster AN phages with a single tail assembly chaperone gene, adjacent lysin A genes (L-Ala-D-Glu peptidase
domain followed by the N-acetylmuramoyl-L-alanine amidase domain), a single reverse gene encoding a helix-
turn-helix DNA binding domain protein, and an HNH endonuclease at the far right arm of the phage. We
74
annotated an often-missed gene immediately upstream of Laila’s tape measure gene. Finally, we continue
working to characterize our anti-mycobacteriophage protein serum and perform fusion experiments to
establish hybridomas that produce monoclonal antibodies against mycobacteriophage proteins.
75
11th Annual SEA Symposium Abstract
Nyack College
Nyack NY
Corresponding Faculty Member: Jackie Washington ([email protected])
Angela M De Jesus
Non-Mycobacterial Actinobacteriophages Providing More Insight to Phage
Biology
Angela M De Jesus, Mariana P Moraes, Jailyne E Aguilar, William S Cruz, Rebekah E Graham, Morgan A Hans,
Hannah R Klumb, Julianna R Kranes, Joey F Leveroni, Thaina Petit-Frere, Nicolas J Plaja, Yonel A Rodriguez,
Desiree A Torres, Zachary L Trador, Benjamin Wasem, Peter J Park, Jacqueline M Wasington
Isolation and characterization of non-mycobacterial actinobacteriophages continue to increase our knowledge
about bacteriophage biology. This year at Nyack College we isolated a total of fifteen phages, which included
eight Gordonia terrae phages, two Rhodococcus phages and five Microbacterium phages isolated using
Microbacterium paroxydans and Microbacterium foliorum as hosts. One Microbacterium phage DizzyRudy (EL)
and two Gordonia phages Ewald (DT) and MintFen (CV) were sequenced. Of these, DizzyRudy seemed to be
particularly interesting as there are only 2 other members of the cluster, all having a minimum of 5 novel
genes. DizzyRudy is 55, 815 bp with 89 genes, including several putative major tail genes and numerous
predicted membrane proteins. The phage does not contain an immunity repressor or gene such as an
integrase which would allow it to be maintained in the host cell as a prophage. No lysogens have been
recovered.
Most bacteriophages have a narrow host range and typically only infect one bacterial host but some phages
have a wider host range. Consequently, host range experiments were performed using several
Microbacterium strains including M. chocolatum, M. testaceum, M. radiodurans, M. saperdae, M.
ketosidreducens and M. arborescens to determine if any of our isolated bacteriophages were able to cross
infect other species. MaeLinda which was isolated using M. foliorum was able to infect M. ketosidreducens
with an efficiency of plating of 1. To understand this we performed phylogenetic analysis of these strains
based on 16S rRNA sequences to determine the degree of relatedness to M. foliorum and the results will be
presented.
To date, the nature of most receptors used for actinobacterial phage infections are not known and in addition,
we do not understand why some bacteriophages have a wider host range. Therefore, understanding this will
give us insight into bacteriophage – host interactions. The first step of bacteriophage infection of a host is
recognition of a specific receptor which may be protein, carbohydrate or other cell membrane associated
structures. To determine the type of receptors used by different bacteriophages, the results of ongoing
76
experiments will be presented. Preliminary experiments have shown that the Gordonia phage Ewald(DT) has a
reduced ability to infect the host bacteria in the presence of spermidine. Polyamines such as spermine and
spermidine have been shown to block porins present in bacterial cell wall used by some phages as a port of
entry into the cell. This result suggests that a porin is required for Ewald to infect Gordonia terrae. We will
also present our results of experiments to identify specific bacterial receptors using transposon mutagenesis.
77
11th Annual SEA Symposium Abstract
The Ohio State University
Columbus OH
Corresponding Faculty Member: Sarah Ball ([email protected])
Sabré Randall
Singleton No More: MargaretKali Finds a Match in Kumotta
Sabré Randall, Sarah Ball, Caroline Breitenberger, Charles Daniels
During our eight years of participation in the SEA-PHAGES program, students from The Ohio State University
have isolated over 1,000 bacteriophages, with 171 being archived and entered on Phagesdb.org and 48
sequenced genomes representing 12 clusters. In 2017, we isolated our first singleton, MargaretKali, using the
host Arthrobacter sp. 21022, but it did not remain a singleton for long. Kumotta, which was isolated from a soil
sample collected in 2018, was found to have enough similarity to MargaretKali to form a new cluster, FB.
Kumotta’s genome is 40,3017bp in length with a GC content of 60.8% (compared to MaragretKali’s 39,448 bps
and 61.1% GC content). The two genomes share a nucleotide similarity of 98% over the majority of their
lengths, except for the first nine open reading frames (~7800bp), a span of about 2,300bp in the middle of the
genomes and the final 1,000bp. Kumotta contains 70 predicted open reading frames, of which 15 are still
classified as orphams despite the similarity to MargaretKali. The majority of these orphams have BLASTP hits to
hypothetical proteins of several Actinobacteria genera, perhaps suggesting the presence of prophages.
78
11thAnnualSEASymposiumAbstract
OuachitaBaptistUniversity
ArkadelphiaAR
CorrespondingFacultyMember:RuthPlymale([email protected])
ThomasRHarrington
NoahRThompson
LysogenichostbacteriumaltersplatingefficiencyofGordonia
bacteriophage
ThomasRHarrington,NoahRThompson,HaydenHBowman,GracieCJones,ElijahJBegin,ErinEChappell,
GracenLHambrick,AllieEHarris,BennettLHasley,CadeMHaynie,GriffinAHopkins,CarleeBHutchins,Dane
AJester,JennyJJohnson,AllisonPMartin,KevinDMerino,CelesteNPinkerton,GabePoe,TaylorDSavage,
ZaneSmith,HunterSmith,TimothyASpiva,LibbyLThompson,RyaneEThurman,CalebTWest,NathanS
Reyna,RuthCPlymale
BacteriophageinfectingGordoniaterrae3612orGordoniarubripertinctaNRRLB‐16540wereisolatedfrom
soilsamplesbyOuachitaBaptistUniversitystudentsandtheGordoniahostrangeofeachphagewas
determined.MostphagewereabletoinfectbothGordoniaspeciesbutdisplayedahigherplatingefficiency
ontheisolationhost.Duringthehostrangescreeningprocess,weobservedlysogenformationbyG.terrae
bacteriophageDelRioandRuthyonbothG.terraeandG.rubripertincta.Weharvestedvirionsfromallfour
lysogens—G.terrae(DelRio),G.rubripertincta(DelRio),G.terrae(Ruthy),andG.rubripertincta(Ruthy)—and
platedthemonbothGordoniaspecies.Lysogenbacterialspecieshadamarkedinfluencedoninfectivity,with
virionsisolatedfromG.terraelysogensexhibitingadrasticreductioninplatingefficiencyonG.rubripertincta,
whereasvirionsderivedfromG.rubripertinctalysogensinfectedbothG.terraeandG.rubripertinctawith
similarplatingefficiency.Thisdifferentialinfectivitywasobservedimmediatelyafterlysogencreation,
suggestinghost‐inducedimpactstophageproteinexpressionorpost‐transcriptionalmodificationratherthan
changestophagegenomesequence.Virionsharvestedfromeachlysogenarebeinganalyzedusingmass
spectrometryandresultsofthatanalysiswillbepresented.
79
11th Annual SEA Symposium Abstract
Providence College
Providence RI
Corresponding Faculty Member: Kathleen Cornely ([email protected])
Colby Agostino
Isolation of 15 novel mycobacteriophage from soil on the campus of
Providence College
Colby Agostino, Ethan Dionne, Olivia Schmitt, Samantha Oltavaro, Maxwell Sinoway, Kathleen Cornely
Our research team isolated 15 novel mycobacteriophage from soil collected on the campus of Providence
College. Mycobacterium smegmatis was the host bacteria utilized during experimentation. Infecting M.
smegmatis with phage was necessary to proliferate the population of phage and purify the phage populations.
Multiple rounds of purification were necessary to obtain a homogeneous population of each novel phage. The
plaque morphologies of each novel phage, which were determined after purification, were used as evidence to
determine whether the phage reproduction cycle was lytic or temperate. The DNA from each phage was
extracted and a restriction digest of the phage DNA was then performed using a HaeIII restriction enzyme; the
restriction digest was necessary to ensure that each phage was indeed a novel phage. The DNA from each
phage was also analyzed via PCR. The detection of a PCR product was used to determine if any of the phage
belonged to clusters B, C, or F. Observation of the phage via electron microscopy confirmed that the
morphotype of all of the phages was Siphoviridae. Two of the phages, Zolita and Skippy, were selected to have
their genomes sequenced at the University of Pittsburgh. Our research team then annotated the genomic
sequences of Zolita and Skippy to determine the location and function of genes found in their genomes. The
data collected in this experiment advances the search for a method to treat Mycobacterium tuberculosis.
80
11th Annual SEA Symposium Abstract
Purdue University
West Lafayette IN
Corresponding Faculty Member: Kari Clase ([email protected])
Lauren Novak
Comparative genomic analysis of mycobacteriophages Krili, Corazon,
Kanye, Nitzel, and Smooch
Lauren Novak, Avantika Ajey Bhardwaj, Serena Birdinc, Katelyn Bormett, Morgan Callin, Misbah Chagpar, Elijah
Cline, Ivy Crank, Rachel Damge, Julianne Dejoie, Davide Delisi, Nathan Everett, Chao Fu, Shruthi Garimella,
Anna-Nikol Georgiev, Mikaela Hand, Alexander Harris, Ben Howard, Jenna Ischinger, Matthew Jaeger, Kierra
Jammer, Jin Jang, Cindy Jiang, Liam Johnson, Connor Jones, Gwen Joseph, Eung Baek Kim, Emma Lietzke, Mai
Liu, Sarah Liu, Estefania Martinez, Melanie Martinez, Brittney Mavrenovic, Korie McCrea, Marina Mehling, Alex
Murfee, Abigail Murphy, Kathryn Myers, Quynh Nguyen, Maddie ONeill, Lauren Oparah, Paula Pandolfi, Nikita
Patil, McKenna Pineau, Julio San Martin Lopez, Emily Sanders, Gabby Selvia, Kylie Snyder, Taylor Sorrell,
Sharonluz Torres, Lina Trigg, Kiersten Troyer, Kess Turner, Bach Vu, Remington Wilson, Ryan Wollensak, YinTae
Wyss, Eunhui Yoo, Neil Zhao, Sarah Bell, Janice Ying Li Chan, Emily Kerstiens, Joseph Krampen, Austin Larson,
Mikael Reuhs, Jacob Riedel, Christina Sanchez, Gillian Smith, Ikenna Okekeogbu, Kari L Clase
Mycobacteriophages (hereafter referred to as phages) are ubiquitous viruses that infect mycobacteria. They
have potential uses in the field of biotechnology and medical science with applications ranging from disease
diagnosis, through phage typing, phage vaccine and phage therapy. Meanwhile, only a meager number of
phages have been identified and characterized out of the multitudes present in the biosphere. In addition, a
far majority of the bacteriophage genes that are discovered have no known function. In this study, five novel
phages namely, Krili, Corazon, Kanye, Nitzel, and Smooch were annotated per the most recent guidelines using
both PECAAN and DNA Master. While Krili was isolated and characterized at Purdue University, the other four
phages were adopted from other institutions (see PhagesDB.org) for annotation. Of the characterized phages,
Nitzel, classified as a cluster F phage, has the smallest genome size of 54kbp, and GC content of 61.3%.
Corazon, a cluster S phage with genome size 65kbp has a GC content of 63.4%; Krili and Smooch from cluster
O, both have a genome size of 71kbp and a GC content of 65.4%; while Kanye, a cluster E phage has a genome
size of 75kbp and GC content of 63.1%. All five phages have the Siphoviridae morphotype. Only Kanye has a
temperate life cycle, while the other four have the lytic life cycle. The right arm of Nitzel is characterized by
many small genes, most with an overlap of 4 bp. Kanye has two tRNAs, while Nitzel has only one tRNA.
Corazon, Krili, and Smooch have no tRNA. The cluster O phages, Krili and Smooch have their genomes flanked
by reverse genes on the 5’ and 3’ ends. Corazon has two holin genes with each located downstream of each
lysin gene, while Krili, Nitzel, Kanye and Smooch have only one holin gene. Structural genes such as terminase,
81
portal, capsid maturation protease, scaffolding, major capsid, head-to-tail adaptor, major tail, tail assembly
chaperone, and tape measure proteins were located in the 5’ upstream region of the genomes of Nitzel and
Kanye. However, for the genome of Corazon, Krili and Smooch, these structural proteins are located in the
middle of the genome. Corazon also has an unusual gene organization with some of its minor tail proteins
located in the far right arm of the genome. The genomes of Smooch, Krili, Nitzel, Corazon and Kanye have 88
(70%), 88 (68%), 55 (56%), 75 (67%) and 82 (58%) genes with no known function respectively. Nitzel and Kanye
have more members in their phage clusters and a lower frequency of genes with unknown function. The
clusters of Smooch, Krili and Corazon have fewer members which may explain the higher frequency of genes
with no known function in comparison to Nitzel and Kanye.
82
11th Annual SEA Symposium Abstract
Queens University of Charlotte
Charlotte NC
Corresponding Faculty Member: Jennifer Easterwood ([email protected])
Irene Kuriakose
The Isolation and Annotation of Bacteriophages “MCubed” and “Nucci”
Irene Kuriakose, Joanna Katsanos, Jennifer Easterwood
Bacteriophages “Nucci” and “MCubed” were discovered during Queens’ third year in the SEA-PHAGES
program. Both phages were identified from soil samples collected from a chicken coop in Charlotte, NC. Using
the host Microbacterium foliorum (M. foliorum), enriched isolation methods were carried out by students in
the biology department to locate the presence of phage. Purification and amplification techniques followed.
Plaques from “Nucci” were clear, round, and typically less than 1 mm while “MCubed” displayed round, hazy
plaques that were approximately 1mm. Transmission Electron Microscopy revealed that both phages exhibit
the siphoviridae morphotype. While “Nucci” has a head diameter of 60 nm and a tail of 121 nm, “MCubed” has
a head diameter of 51 nm and a tail measuring 140 nm. After DNA extraction, the phages were sent to the
Pittsburg Bacteriophage Institute for sequencing. Using the bioinformatics software DNA Master and resources
HHpred, Starterator, Phamerator, and NCBI blastp, students annotated the genomes of “Nucci” and
“MCubed”. Both phages belong to the EA cluster, with “MCubed” being one of six phages in the EA2 subcluster
and “Nucci” being the only identified phage in subcluster EA10. “Nucci” contained 40,281 base pairs and a
63.7% Guanine-Cytosine (GC) content while “MCubed” contained 40,381 base pairs and a 62% GC content.
Both genomes had 63 open-reading frames, with over half identified as reverse genes.
83
11th Annual SEA Symposium Abstract
Queensborough Community College
Bayside NY
Corresponding Faculty Member: Urszula Golebiewska ([email protected])
Valesca Polycarpe
Annotations and Analysis of LilMoolah
Valesca Polycarpe, Deidre Seepersaud, Muhabbat Ahmedova, Calli Atamian, Biling Chen, Yiching Chen, Winnie
Chow, Samentha Duffault, Brettania Gordon, Kamaljeet Kaur, Prabhjot Kaur, Dhanmattie Khan, Amirabbas
Maghsoudi, Nishat Neela, Jennifer Ogbozor, Anastasia Parks, Megan Pirtle, Yusra Raza, Pamela Joy Tabaquin,
Divya Thakur, Roxine Tyndale, Britney Vasconcellos, Vincent Zhong, Urszula Golebiewska
Students at Queensborough Community College annotated and analyzed the genome of Mycobacterium phage
LilMoolah, a phage discovered in 2017 by Chanel Turner, a student of Queens University of Charlotte in
Charlotte, North Carolina. It was isolated from Mycobacterium smegmatis mc^2 155. LilMoolah is a member of
the Siphoviridae family, characterized by double-stranded DNA and a long, noncontractile tail. It belongs to
cluster F, subcluster F1. Its genome is 58,136 base pairs in length and made up of 109 genes. Various
bioinformatics programs were used for gene annotation and analysis, such as DNA Master, BLAST, Starterator,
HHpred, Phamerator, and others. These were used to determine each gene’s length, coding potential, reading
frame, possible function, and possible relatives. The first half of LilMoolah’s genome contains larger genes,
many of which have well-defined functions; these include terminase, lysin A and lysin B, holin, major and
minor tail proteins, tape measure protein, integrase, and others. However, 65 of LilMoolah’s genes, many of
which are found in the second half of the genome, are much smaller in size and have no defined function.
Most of the genes are read in the forward direction. The closest relatives to LilMoolah are RitaG, Mattes, and
Nivrat, with Nivrat sharing the highest number of homologous genes with LilMoolah.
84
11th Annual SEA Symposium Abstract
Radford University
Radford VA
Corresponding Faculty Member: Joy Caughron ([email protected])
Connor Fox
Exploring the effects of environmental factors on the phylogeny of
bacteriophages
Maxwell Barney, Connor Fox, Pravin Garskof, Jonathan Gibson-Cromer, Maria Gonzalez, April Hiett, Kelly
Hodges, Laneigh Jones, Clint Krysa, Autumn Roberts, Jessica Wyllie, Joyce Caughron, Robert Sheehy
The purpose of this experiment is to collect environmental data gathered during the initial collection of the
chosen EA1 sub-cluster phages and use this data to find trend in environmental significance of phage survival
and phage distribution. By taking the data found and documented during phage collections, the environmental
trend of selected phages can be examined as well as the likely displacement patterns of phages. The
distribution is then overlaid with the phylogenetic analysis of the phage genomes at specified open reading
frames that contain tail protein structure products. Two regions were specified to be tested, one containing
high similarity in sequence analysis and synteny and another containing a higher variability region with open
reading frames with tail protein products in the chosen phages. Two additional open reading frames were of
particular interest due to one being annotated as a large gap of over one hundred base pairs consistently in
the EA1 cluster phages as well as another open reading frame that has a possibility of being a recent horizontal
gene transfer due to the coding potential of the host and phage not lining up in an expected pattern. These
analyses are done using information gathered on Phages DB, NCBI Blast, Phamerator, MEGA 7, and
information supplied by the institutions where phages were collected. If environmental factors impact the
distribution and survival capability of phages, then the distribution of sub-cluster EA1 phages will likely overlap
with phylogenetic analysis data of the following bacteriophages: Knox, Aubergine, HanSolo_Draft,
BonesMcCoy, Draft, Tenda, AlexAlder, Gello, Peep, Bonino, StingRay, Schubert, Gargoyle, and Dave.
85
11th Annual SEA Symposium Abstract
Rockland Community College
Suffern NY
Corresponding Faculty Member: Jeffrey McLean ([email protected])
Hannah Elizabeth
Digging for Diesel: A functional analysis of cluster A3 phage Dieselweasel
Hannah Elizabeth, Nicole Esposito, Niola Etienne, George Joseph, Alexis Kangootui, Michael Lenyk, Riley
Luczkiewicz, Sherlin Mathew, Joseph Patyi, Sarah Pollak, Jeanine Siegel, Karen Umana, Ra'Vynn Waters, Jeff
McLean
DieselWeasel is a lysogenic A3 phage with 87 genes, including 4 TRNAs. The evidence collected from
bioinformatics tools such as PECAAN,Phaster and BLAST have shown that Dieselweasel can potentially
integrate into mycobacterial species other than M.smegmatis. By ensuring adhesion to host receptors during
the initial phases of infection, Minor Tail proteins are essential in the determination of host range in these
bacteriophages. Mycobacteriophage Microwolf, a related A3 mycobacteriophage, is known for possessing a
broad host range, but subcluster identification is not sufficient to identify host range. Therefore, we utilized
Blastp to determine whether DieselWeasel (A3) or Chupacabra (A10) have a minor tail protein sequence
similar to Microwolf. The alignment showed that Dieselweasel and Chupacabra have the same structure in the
Gp5 protein sequence as Microwolf, indicating that these phages may also possess broad host-range. Further,
it was discovered that Dieselweasel may have the potential to integrate into other medically important
mycobacterial species other than M.smegmatis. Analyzing the genome of M. tuberculosis and M. abscessus (a
multi-drug resistant and nontuberculous mycobacteria), it was found that the ATTB site of M.abscessus has a
98-100% similarity to that of the ATTP site of Dieselweasel, inidcating the potential for Dieselweasel to form
prophages in M.tuberculosis and M. abscessus. Disimilarity between the M. abscessus-derived prophages
and
Dieselweasel indicate that Dieselweasel may integrate into these bacterial genom
es even i
n the face of
superinfection. As a lysogenic phage, Dieselweasel and related phages use a stoperator system to inhibit lytic
replication during lysogeny. Stoperators sole purpose throughout these sites are prevent lytic-associ
ated gene
transcription.
Dieselweasel was discovered to possess the same Stoperator sequence as other A3 cluster
phages (GTTCTCTGTCAAG). 9 Stoperators were located in Dieselweasel throughout the 87 genes with the
associated Immuni
ty Repressor found at gene #77. Similarly, A2 Mycobacterium phage Phaded also uses a
stoperator system using the sequence (GGTGGATGTCAAG), similar to other A2 cluster phages. Six differe
nt
stoperator sites and an immunity repressor were found in Phaded, of the 91 genes present in the phage.
Additionally,
as Dieselweasel is a lysogenic phage, it has fewer TRNA than most lytic phages such as HyRo(C1)
and Alice(C1). Collectively the evidence suggests that Dieselweasel has potential for use in the detection
and
molecular manipulation of a broad range of mycobacterial
species.
86
11th Annual SEA Symposium Abstract
Saint Joseph's University
Philadelphia PA
Corresponding Faculty Member: Julia Lee-Soety ([email protected])
Leya C Givvines
Paige V Conrad
There and back again with four Mycobacterium smegmatis
bacteriophages.
Leya C Givvines, Paige V Conrad, Alexandra L Vlahovic, Arianna M Varano, Mia S Somershoe, April E Pivonka,
Isabella Patterne, Shane M Patil, Teagan R McCarthy, Mary C Marino, Alec J Manzi, William R Majewski, Dana L
Glavin, Tate J Fryczynski, Mary Agnus J Dunn, Vanessa D Copes, Joshua R Blackley, Elizabeth C Binder, Corinne
O Merlino, Emily E Costello, Julia Y Lee-Soety
The 2018-2019 cohort of Phage Safari students isolated and characterized 16 different mycobacteriophages
that infect Mycobacterium smegmatis, a close relative of the tuberculosis-causing bacterium Mycobacterium
tuberculosis. By restriction endonuclease digest patterns and transmission electron microscopy, nine phages
exhibited short tails which classified them as myoviridae and likely belonging to the C1 cluster. The other 7
phages had long flexible, non-contractile tails which classified them in the siphoviridae family. Four phages
were sequenced – Kipper29, Mcshane, Giuseppe, and JPickles. Kipper29 was sorted in cluster A6; its genome
of 52,009 base pairs contains 98 genes with 3 genes encoding tRNA. Mcshane was sorted in cluster B1 with
68,929 base pairs containing 103 genes, including an orpham. Giuseppe was sorted in cluster D1 with 64,604
base pairs containing 89 genes. JPickles, with the myoviridae morphotype, belonged to the C1 cluster with
155,116 base pairs containing 228 genes, 36 tRNA genes, and one gene encoding tmRNA. Using both DNA
Master and PECAAN, we have made gene calls and confirmed many proteins that they encode. So far, all four
mycobacteriophages have very similar features as other phages in their respective clusters. After 4 years of
attempting to isolate phages from other hosts – Arthrobacter and Gordonia – with low rates of success,
87
moving back to M. smegmatis gave every student in the class opportunities to carry out the entire phage
isolation process and gain a sense of accomplishment.
88
11th Annual SEA Symposium Abstract
Saint Leo University
Saint Leo FL
Corresponding Faculty Member: Iain Duffy ([email protected])
Hailey R Kerns
SEA-PHAGES at Saint Leo University: A Roaring Success! Discovery of Novel
Phage, Comparative Analysis and Evaluation of EE and EK Cluster
Bacteriophage Sequences.
Hailey R Kerns, Carissa R Brown, Andrea Gemmati, Laela A Ouellette , Kaishon M Showers , Lisa Ogueke, Emily
Katz, Victoria Latalladi, John Duncan, Iain Duffy
In Fall 2018, Saint Leo University was inducted into Cohort 11 of the SEA-PHAGES Program. In our first year, a
total of fourteen bacteriophage were isolated from soil samples, using the bacterium Microbacterium foliorum
as host. The soil samples were acquired at various locations, from Florida to Maryland, with the home campus
of Saint Leo University providing the most popular site. The isolation, purification, titer determination, and
further assessments of the bacteriophage were done using protocols provided by the SEA-PHAGE program.
Plaque morphologies were ascertained, and transmission electron microscopy performed. RFLP analysis of
bacteriophage genomic DNA was also undertaken, in addition to the utilization of a host specificity assay.
Sequencing data from three of those phage were obtained and analyzed. One was an EE cluster phage
[Kaijohn]. This cluster currently has 28 members, of which, 14 have been annotated. Kaijohn is analogous in
sequence and gene arrangement to its closest cluster phamily members, as seen in Phamerator. Kaijohn would
also appear to share the gene 10 and 11 gene slippage motif for the formation of the tail assembly chaperone
protein. The sequences of two further phage, both EK, were obtained. One of those genomes [Wesak] has
been identified as an EK1 cluster member. At the time of obtaining the sequences only one previous EK1
phage, ArMaWen, had been annotated, however, there are three other draft EK1 genomes awaiting final
annotation. It would appear that Wesak has a close relative in another draft phage, Tiny Timothy, however it
would seem that both have several genes that differ from the annotated ArMaWen phage. While Wesak
shares many similarities with Tiny Timothy, there are intriguing differences. These include the fact that both
Wesak and Tiny Timothy have orphams at genes 16 and 17, however, both of those genes have initially been
designated as distinct orphams. Gene 35 in Wesak has a similar relative in Tiny Timothy but is also seen in the
phage Araxxi, an EM cluster phage, but these are the only known instances of those genes. While gene 36 in
Wesak is again, a member of the same phamily as gene 36 in Tiny Timothy [the only two members of this
phamily], gene 37 is seen in both but also in Burro, another EM phage. Wesak would then also seem to have
89
another orpham in gene 39. The other sequenced EK phage, Blue Rugrat, has not been recognized officially
yet, and so has yet to appear in sites such as Phamerator. However, we have been able to use programs such
as DNA Master and NCBI Blast to analyze the similarities and differences with Wesak.
90
11th Annual SEA Symposium Abstract
Salem State University
Salem MA
Corresponding Faculty Member: Amy Sprenkle ([email protected])
Cassandra R Kysilovsky
A Study in Contrasts; Annotation of an AR and J Cluster
Actinobacteriophage from the Genome Exchange.
Cassandra R Kysilovsky, Amy B Sprenkle
In the inaugural SEA-PHAGES Bioinformatics semester at Salem State University, we annotated two phage
genomes from the Genome Exchange at the Acintobacteriophage Database. The phage genomes were
selected to provide the optimal training in developing the curriculum around using the bioinformatics tools
provided by the program. The first phage annotated was the Arthrobacter phage Mordred. Mordred is a lytic
Siphoviridae found in Northampton, MA from a direct isolation. Mordred’s genome is just over 70 kilobase (kb)
pairs and is in the AR cluster. We found the genome to be very closely related to members of the cluster, with
no orphams or unusual annotation challenges. The second phage was the Mycobacterium phage Hannaconda,
a lysogenic Siphoviridae found in a potted succulent from a Pittsburgh, PA Ikea also from a direct isolation.
Hannaconda is in cluster J, and is over 111 kb. This large genome was significantly less related to members in
cluster J, which is characterized by large genomes with orphams, mobile genetic elements, intron splicing in
capsid proteins, and tRNAs, all of which provide a much more significant genome annotation challenge. The
online bioinformatics guide, DNA Master, Phamerator and PECAAN were all thoroughly explored and utilized
to complete the annotation of our phirst phage genomes.
91
11thAnnualSEASymposiumAbstract
SouthernConnecticutStateUniversity
NewHavenCT
CorrespondingFacultyMember:NicholasEdgington(edgingtonn1@southernct.edu)
StephaniePreising
AmeliaHoyt
CharacterizationofanewMicrobacteriumfoliorumClusterEBphage
'Stromboli':Ataleoftoxins,giantlysins,HNHendonucleases,andagene
clusterpredictedtoregulatenucleotidelevels.
StephaniePreising,ZacharyWilliams,KarinaMartinez,LindsayKashuba,PerpetualTaylor,MiaForgione,Faruk
Senturk,EleanorTinsley,RichardSzeligowski,JohneshaBrown,ShannonBarrett,AmeliaHoyt,NicholasP
Edgington
StromboliisanewmemberoftheClusterEB,aclusterthatinfectsthebacterialhostMicrobacteriumfoliorum.
Ithasa41,594bpgenomeandaGC%of68.8.Itisoneofeighteenmembersinthiscluster,isinthe
Siphoviridaefamily,producesa'bullseye'plaquemorphology,andispredictedtobealyticphage.Ithasan
unusuallylargelysinAwhichcontainsseveralrepeats.WewillpresentaphylogeneticanalysisoftheTypeII
HicABsystempredictedinMicrobacteriumandactinobacteriophages.Strombolialsocontainstwopredicted
HNHendonucleases,tRNAs,andseveralgenesthatarepredictedtoencodeenzymesthatregulatenucleotide
levelsinthebacterialhost.
92
11th Annual SEA Symposium Abstract
Southern Maine Community College
South Portland ME
Corresponding Faculty Member: Brian Tarbox ([email protected])
Matthew Davis
Seasonal lysogeny in temperate water marine phage
Matthew Davis, Theodore Bishop, Lily Cox, Crystal Turner
Many temperate water marine phage are thought to form lysogens over the winter months. While searching
for a marine Actinomeycete host in the Spring 2019 semester the team at Southern Maine Community College
(SMCC) encountered difficulties infecting potential hosts isolated from the marine environment. Potential
hosts were isolated from biofilms on marine invertebrates, macroalgae, rocks and sediments. The hosts were
used in enrichment cultures in an effort to find phage specific to them. Hosts were gram stained and gram
positive hosts were identified to genus by DNA barcoding a portion of the 16srRNA gene. All the gram positive
hosts were in the Firmicutes and none of the enrichments yielded phage. We hypothesized that the majority of
marine phage form lysogens in the cold months and designed an experiment to test this hypothesis. Three
enrichments were done using biofilms from lobsters, tunicates and sediments obtained from the marine
environment (ambient temperature 3-7 degrees C) and comparable sources from a heated, recirculating wet
lab (18 degrees C). In each case no infection was observed from the 3 degree water and infection was
observed in hosts isolated from biofilms in the 18 degree water thus supporting our hypothesis of cold
temperatures leading to lysogeny. These results are discussed in the context of the “piggyback the winner”
hypothesis of marine lysogeny.
93
11th Annual SEA Symposium Abstract
SUNY Old Westbury
Old Westbury NY
Corresponding Faculty Member: Christos Noutsos ([email protected])
mechanisms of Genome Expansion in Phages
Iman Raja, Fernando Nieto, Christos Noutsos
Bacteriophages are viral organisms that propagate through the infection of bacterial hosts. Their ability to do
so is influenced by the amount of DNA within their capsid. This indicates the presence of evolutionary
pressures, leading towards gene-creating mutations. In this project, the mechanisms of genome expansion are
studied that could potentially lead to new phage strains. Three modes of genome expansion were noted:
Expansion of existing genes by inteins, Insertions of newly encoded genes, and de novo genes. For further
investigation, models were developed. For the first mode, certain phams unique to each Cluster were
repeatedly expanding among aligned pairs. After being tested for Synonymous/Non-synonymous substitutions,
seven showed neutral/negative selection while two demonstrated neutral/positive selection. For the second
mode, Insertions, the developed hypothesis indicates that the observed new genes were part of an ancestral
phage that may have been passed down through positive selection. For the third mode, de novo genes were
noticed throughout the phage genomes due to a few nucleotide deletions in their sequences. When those
deletions were filled in, the genes disappeared. Overall, several factors causing genome expansion among
Bacteriophages were revealed.
94
11th Annual SEA Symposium Abstract
Tarleton State University
Stephensville TX
Corresponding Faculty Member: Dustin Edwards ([email protected])
Faith Cox
Isolation of Cluster EA2 Bacteriophage Finny
Faith Cox, Stacy Luka, Tiffany Lee, Michaela Aguirre, Shey Andrews, Kayla Bahr, Abigail Ballard, Matthew
Bristerpostma, Leah Dowell, David Kiker, Tiffany Lujan, Haze Murphy, Abbigal Ramirez, Rheaven Sandoval,
Kenneth Underhill, Julie Edwards, Dustin Edwards
Bacteriophage Finny was purified from Microbacterium foliorum at 29° C in PYCa media by direct isolation
method from a soil sample collected from a chicken coop in New Braunfels, Texas. Following initial isolation,
two rounds of serial dilutions and plaque assays were performed for bacteriophage isolation and purification.
Bacteriophage Finny plaque morphology consists of small-to-medium-sized lytic plaques with turbid halo rings.
High titer lysate was stained with uranyl acetate to visualize bacteriophage Finny by transmission electron
microscopy, which showed the virus has Siphoviridae morphology with an icosahedral capsid. DNA was
extracted by a zinc chloride method and the whole genome sequenced at the Pittsburgh Bacteriophage
Institute. Whole genome sequence comparison determined that bacteriophage Finny is a Cluster EA2 cluster
with a circularly permuted genome 40,313 bp in length with 62.1% G+C content. Bacteriophage Finny genome
contains 63 predicted protein-coding genes, including lysin A, holin, RecA-like DNA recombinase, AAA-ATPase,
MazG-like nucleotide pyrophosphohydrolase, thymidylate kinase, and ThyX thymidylate synthase.
95
11th Annual SEA Symposium Abstract
Truckee Meadows Community College
Reno NV
Corresponding Faculty Member: Tina Slowan-Pomeroy ([email protected])
Abigail T Peterson
Characterization and Genomic Analysis of Mycobacteriophages Lewan and
Heathen, Including Host Range Investigation of Phage Heathen
Abigail T Peterson, Keziah Dutt, Heather Bohn, Kristen Sommerfeld, Ethan Pierrot, Deanna Lewis, Frank H
Robertson, Tina Slowan-Pomeroy, Laura A Briggs
The goal of this research was to isolate, purify, and characterize bacteriophages found in Northern Nevada
soils. In conjunction with the Howard Hughes Medical Institute’s Science Education Alliance Phage Hunters
Advancing Genomics and Evolutionary Science (SEA-PHAGES) program, this research expands our
understanding of the diversity of bacteriophages in this region. The focus of this study was on
mycobacteriophages Heathen and Lewan. Both phages were isolated from soil in Reno, NV using the host
Mycobacterium smegmatis mc
2
155. Heathen was found in 2015 and Lewan was found in 2018. Each phage
was isolated and purified by the plaque purification method until uniform plaques were obtained. Lewan has
turbid plaques ranging in size from 1-2 mm in diameter, indicating possible lysogeny. Heathen has bullseye
plaques 3mm in diameter, also indicating possible lysogeny. Phage DNA was extracted from both lysates and
sent for sequencing at the Pittsburg Bacteriophage Institute, followed by annotation using PECAAN and
Phamerator. Lewan is a subcluster L2 mycobacteriophage with a GC content of 59.0% and a genome length of
76734 base pairs with 137 genes and 13 tRNAs. Heathen is a subcluster A3 mycobacteriophage with a GC
content of 64.0% and a genome length of 50143 base pairs with 87 genes and one tRNA. Heathen contains 2
orphams and Lewan contains 4 orphams. Heathen shows 99.7% and 98.14% sequence similarity to A3 phages
HelDan and Fred 313, respectively. Lewan shows 98.08% and 98.07% sequence similarity to L2 phages
mkalimitinis3 and Crossroads, respectively. Host range analysis of 7 actinobacterial strains, showed Heathen
can cross infect Gordonia terrae 3612, Rhodococcus erythropolis RIA643, Mycobacterium phlei NCTC8151 and
Mycobacterium tuberculosis H37Ra. Host range testing for Lewan is pending. Heathen contains both a tyrosine
integrase gene (gp32) and an immunity repressor (gp70) while Lewan contains a tyrosine integrase gene
(gp38), immunity repressor (gp40), Cro (gp41), and excisionase (gp42), all suggesting possibly lysogeny. Future
research will investigate the temperate nature of these two mycobacteriophages.
96
11thAnnualSEASymposiumAbstract
UniversityofAlabamaatBirmingham
BirminghamAL
CorrespondingFacultyMember:DeniseMonti([email protected])
RoseMAlbert
CarlyRSnidow
ImmunityTestingasaProbeforPhageDiversityPriortoFull‐Genome
Sequencing
RoseMAlbert,AlecAyala,MiaSBradley,ReubenEBurch,MandyChen,AnnaGraceDulaney,PranavS
Kakulamarri,KellyUKim,SethDMaynor,AreebahINur,SarahEPerritt,HrithikPraveen,DylanMSlemons,
CarlyRSnidow,SashaThalluri,AtharvaKVyawahare,MckinleyRWilliams,DeniseLMonti
Bacteriophagesfollowoneoftwodistinctlifecyclesuponinfectionofapermissiblebacterialhost.Lytic
phagesinjectphageDNAintothebacteriaandhijackthemetabolicsystemsofthehosttomakenewviral
particles.Thereleaseofprogenyviralparticlescausesthehostcelltodiewhichresultsinthepresenceof
visibleplaquesonalawnofhostbacteria.Incontrast,temperatephagesinfectthehostandthephage
genomeintegratesintothehostbacteriagenomeviauseofthephageintegrase.Subsequentsuppressionof
phagegenetranscriptionismediatedbythecognatephagerepressor.Eachtimethebacteriahost(nowcalled
alysogen)replicates,theintegratedphagegenome(prophage)isreplicatedalongwiththehost.Undercertain
conditions,thephagegenomeexcisesfromthehostandthephageentersintothelyticcyclewhichoften
resultsinturbidplaquesonabacterialawn.In2017,studentsatUABisolatedfivenewCorynebacterium
phagesinfectingthehostC.xerosis(Juicebox,KobeBeanBryant,StAB,SamW,Troy).Stablelysogenswere
isolatedfromallfivephagesandcross‐infectionstudiesshowedthatphageswithsimilargenomes(SamWand
Troy)werehomoimmune,whilephageswithdissimilargenomes(SamWandKobeBeanBryant)were
heteroimmune.Infall2018,weisolated17additionalphagesinfectingthehostC.xerosis.Preliminary
genomecharacterizationusingrestrictionendonucleasedigestionshoweduniquebandingpatternsformany
ofthephagessoimmunitytestingusingthe5lysogensfrom2017wasusedasasecondarycriteriafor
97
sequencingselection.Fivephages(Adelaide,Bran,Dina,Lederberg,Stiles)wereselectedforfull‐genome
sequencingandannotatedinspringof2019.Fourofthefivesequenced2018C.xerosisphagescontaineda
tyrosineintegrasegeneindicatingmostC.xerosisphagesmaybetemperate.Thus,wesoughttoisolatestable
lysogensforeachofthe17newlyisolatedC.xerosisphagesandcompletedadditionalimmunityexperiments
tofurtherprobethediversityofC.xerosisphagespriortofullgenomesequencing.
98
11th Annual SEA Symposium Abstract
University of California, Los Angeles
Los Angeles CA
Corresponding Faculty Member: Jordan Parker ([email protected])
Andrew Kapinos
Comparative Genomic Analysis of 31 Siphoviridae Reveals Extensive Host-
Dependent Relationships and Novel Phage Subclusters
Andrew Kapinos, Lauren Remijas, Nina Canela Torres, Ryan Ngo, Kris Reddi, Amanda Freise, Jordan Moberg
Parker
Bacteriophages comprise the most abundant group of biological entities on the planet. As a ubiquitous feature
of the Earth’s various ecosystems, this class of organisms is estimated to outnumber all other organisms on the
planet combined. If we are to fully harness the current momentum in phage research, we must continue to
investigate evolutionary relatedness among phages. In this study, we hypothesized that host evolutionary
processes may govern patterns in phage relatedness; as such, we predicted that phage genetic similarities
resulting from coevolutionary pressures would reveal the intricate relationships which exist among phages,
allowing for improved understanding of the bacteriophage pangenome. In our preliminary analysis, the
Gordonia terrae-infecting phage Tanis was selected for genome annotation. Phage Tanis is a member of phage
cluster DJ, a relatively new addition to the phage clustering system: of the 14 member phages that have been
discovered since cluster DJ’s inception, 50% have been isolated in the past year alone. Thus, it is unsurprising
that 76.9% of genes identified during manual annotation possessed no known function. Comparative genomic
analyses were performed using 21 additional Siphoviridae and their hosts (phages were isolated on hosts
belonging to 2 phyla, 3 genera, and 11 species of bacteria). Phage and host phylogenies confirmed expected
patterns of phage- and host-relatedness. Codon usage analyses revealed that phages with similar codon biases
tended to infect hosts belonging to the same genera. Dot plots illustrating phage nucleotide similarity also
revealed extensive regions of conserved nucleotide content, with increased statistical noise among phages
infecting the same host; specifically, Actinobacteriophages exhibited genetic similarities distinct from other
phage groups. Trends in average nucleotide identity (ANI) further supported the relationships observed during
phage dot plot analyses; however, various patterns in ANI values challenged the current organization of
several phage clusters, prompting an expanded investigation which included all known cluster DJ phages.
Notably, our expanded ANI and core gene analyses provided evidence for the subdivision of cluster DJ,
potentially calling for the creation of up to 4 novel DJ subclusters. Overall, the predominance of genes with
unknown function in the Tanis genome demonstrated the need for continued research on phage biology.
Initial comparative analyses supported a mechanism for phage-host coevolution, wherein the evolutionary
distance between phages was directly proportional to the evolutionary distance between hosts. ANI analysis
supported qualitative measures of phage relatedness and suggested the reorganization of cluster DJ phages
99
into discrete subclusters. In sum, our individual and comparative genomic analyses provided insight into the
complexity of this growing field, while demonstrating the need for ongoing reevaluations of phage relatedness.
100
11th Annual SEA Symposium Abstract
University of California, San Diego
San Diego CA
Corresponding Faculty Member: Rachel Dutton ([email protected])
Avani Mylvara
Isolation and Characterization of A0 subcluster Arthrobacteriophage King2
and BK1 sublcuster Streptomyces bacteriophage Beuffert from soil
samples in San Diego County
Avani Mylvara, Isaac Chang, Samantha Tuohey, Lauryn Reugg, Chaylin VanDenburgh, Tracy Le, Madeline
Dunsmore, Liliana Zamora, Paty Esquer-Romero, Jennifer Park, Jeffrey Keller, Alison Washburn, Patrick
Akarapimand, Grace Kim, Ceasar A De La Fuente, Emily Morton, Calvin Ha, Andrew Mueller, Lena
Krockenberger, Adrianne N Santa Romana, Lou Devanneaux, Brian Khov, Taylor Lichtenberg, Thisha
Thiagarajan, Lydia Irons, Victoria Ortiz, Samantha Licona, Rachel Dutton, Swarna Mohan
In the Phage Genomics Research initiative course at UCSD, students isolated 9 Streptomyces platenis phages
from soil samples and another 9 Arthrobacter sp. phages. The phages were characterized after direct isolation
by restriction enzyme digestion and gel electrophoresis.
Genomes of one Arthrobacteriophage, King2, and one Streptomyces phage, Beuffert, were sent to the
Pittsburgh Bacteriophage Institute for sequencing. Phage King2, a lytic myoviridae phage, belongs to subcluster
AO1, all of which only infect Arthrobacter sp., strain ATCC 21022. King2 and has 75 genes in 50,000 base pairs.
30 of these genes had known functions while the remaining 60% of genes had unknown functions; King 2 does
not encode for any tRNAs.
Phage Beuffert, a lytic siphoviridae phage, belongs to subcluster BK1 and infects Streptomyces platensis
MJ1A1. Beuffert has 130,000 base pairs with 238 genes and GC content of 47.7%. 39 of these genes had known
functions, making 83.6% of gene functions unknown. Beuffert also encodes for 34 tRNAs. Comparisons of
Beuffert and King2 to other phages in their subclusters using BLAST and Phamerator revealed several highly
conserved genes and potential functions. Our research revealed substantial diversity in the final draft
annotation of these phages’ genomes by identifying genes and comprehensively examining their functions.
Our annotations can benefit other researchers in determining further unknown, novel gene functions in similar
phages and can benefit other researchers in finding new uses for such phages, like phage therapy.
101
11th Annual SEA Symposium Abstract
University of Central Oklahoma
Edmond OK
Corresponding Faculty Member: Hari Kotturi ([email protected])
Alyxandracam: A Newly Isolated and Annotated Microbacteriophage
from Oklahoma Soil
Cameron Kedy, Alyxandra Siemer, Destinee Wilkins, Hari Kotturi
Bacteriophages are viruses which selectively invade bacterial host cells, taking control of the enzymatic
machinery associated with replication and subsequently multiplying within the host. Throughout this project,
our goals were to isolate a microbacteriophage from Oklahoma soil, characterize it, sequence and annotate its
genome. The microbacteriophage Alyxandracam was isolated from reddish-brown clay soil located in a field
near a residential area. We used the direct isolation method for isolating the phage and did three rounds of
plaque purifications to obtain a pure phage. We used webbed plates for obtaining a 2.3 x 10
10
pfu/mL high titer
concentration, and transmission electron microscopy revealed a siphoviridae morphology. Phage DNA was
extracted using the PCI method and was sequenced via Illumina sequencing technology. These methods
enabled us to isolate, characterize and sequence a microbacteriophage from Oklahoma soil successfully.
Bioinformatics tools were used to annotate Alyxandracam’s genome. Our phage has a circularly-permuted,
41,770 bp genome with 63.4% GC content. Alyxandracam belongs to cluster EA and subcluster EA1, and
appears to enact a lytic viral cycle. Alyxandracam has 63 genes, 25 of which appear to have known protein
function based on BlastP and HHPred comparison. No tRNAs were found, and there did not appear to be a
translational frameshift within the tail assembly chaperone genes.
102
11th Annual SEA Symposium Abstract
University of Colorado at Boulder
Boulder CO
Corresponding Faculty Member: Christy Fillman ([email protected])
Daniel Feeny
Characterizing Genetic Elements in the Cluster O Mycobacteriophage
Blessica
Daniel Feeny, Daria Nicke, Jack Carter, Luis Deschamps, Sarah Grout, Alex Haberman, Caleb Hanson, Jordan
Kassanoff, Sophie Nabb, Daniel Petito, Gregory Prahl, Zachary Rotblatt, Ojaswi Uprety, Josh Wild, Nancy Guild,
Christy Fillman
Cluster O bacteriophage genomes are highly conserved and contain several characterized genetic elements
including a MPME (Mycobacteriophage Mobile Element), inverted repeat sequences, and SigA promoter
sequences. In this study we compared a new cluster O phage, Blessica, to other cluster O mycobacteriophages
and identified these sequence elements, which provided insight into the evolutionary history of these phages.
103
11th Annual SEA Symposium Abstract
University of Connecticut
Storrs CT
Corresponding Faculty Member: Simon White ([email protected])
Tony Li
Using Maximum Likelihood Phylogenetic Trees to Assess Horizontal Gene
Transfer in Bacteriophages and Archaeal Viruses
Tony Li
Bacteriophage evolutionary biology has always been difficult to study because of the recombination and
exchanging of genes. Using data from PhagesDB, maximum likelihood phylogenetic trees of the major capsid
protein and a non-structural protein, the viral DNA polymerase, were constructed and compared. With
multiple well supported clades, one specific clade's movement indicates a possible horizontal gene transfer
event while the rest show no sign of gene transfer.
During the annotation of our phage genomes, we found multiple surprising BLAST results matching a dsDNA
phage with Haloviruses, which prompted an investigation of gene transfer between the dsDNA bacteriophages
and Haloviruses. Their trees, though not as strongly supported, indicated much more movement within
families of phages with homologous proteins than would be expected by horizontal gene transfer.
104
11th Annual SEA Symposium Abstract
University of Detroit Mercy
Detroit MI
Corresponding Faculty Member: Stephanie Conant ([email protected])
Demitra Loucopoulos
Annotation of the M. foliorum specific EA1 Bacteriophage Ioannes and
Zada
Demitra Loucopoulos, Andrea Sandoval, Akhteyar Jaeran, Ali Zamat, Ken Dada, Jayla Anderson, Tania
Anderson, Michael Avalos, Adrian Avila, Sheku Bangurah, Kiefer Degener, Razan El Yaman, Mohammad
Hadeed, Leen Issa, Katelynn Kowalski, Yamere Lloyd, Vanessa Manzo, Nicolas Nunez, Semaj Shelton, Steven
Taddei, Jonathan Finkel, Stephanie Conant, Jacob Kagey
Two Microbacterium foliorium specific bacteriophage were isolated from Michigan soil samples and purified.
DNA was extracted and sent to the University of Pittsburg for sequencing, followed by genome annotation by
the 2018-2019 SEAPHAGE course at the University of Detroit Mercy. The phage annotated were Ioannes and
Zada, both EA, subcluster EA1 members. The EA1 subcluster has only 64 total phage identified and annotated
thus far specific to the M. foliorium host as a part of the HHMI SEAPHAGE consortium. Annotations of these
phage genomes identified gene mis-calls, insertions, false positive and false negatives within each genome.
Because of the close similarity of the Ioannes and Zada genomes, phylogenetic comparison of Ioannes and
Zada with other EA1 subcluster members was performed to investigate conserved genome similarities and
protein-folding assessment was performed to identify potential differences resulting from minor nucleotide
sequence changes.
105
11th Annual SEA Symposium Abstract
University of Evansville
Evansville IN
Corresponding Faculty Member: Ann Powell ([email protected])
A Comparison of Three Subcluster BE1 Phage
Michael Anderson, Katelyn Brown, Justin Cummings, Zach Eaglin, Sarah Kempf, Anthony Kluemper, James
Pearce, Storm Poser, Darcie Smith, Spencer Thompson, Joyce Stamm, Ann Powell
Annotation of three subcluster BE1 genomes, Evy, Daubenski, and Braelyn, will lead to a better understanding
of genome structure in Streptomyces phage. Genomes were annotated using PECAAN and functions were
assigned using PhagesDB BLASTp, NCBI BLASTp, and HHpred. tRNA and tmRNA were identified and trimmed
using Aragorn 1.2.38 and tRNAscanSE. Genome size in these phage ranged from 131,234 to 133,090 bp and
annotations identified between 218 and 226 genes. Gene order, genome size, number of genes, and tRNA
number and position match other subcluster BE1 phage. The three genomes also contain the large terminal
repeats of about 10,000bp that are characteristic of subcluster BE1 genomes. Putative RIIA and RIIB-like genes
were identified in all three genomes and this function was supported by NCBI BLASTp and HHpred
comparisons.
106
11th Annual SEA Symposium Abstract
University of Hawaii at Manoa
Honolulu HI
Corresponding Faculty Member: Becky Chong ([email protected])
Chloe G Severson
Determining the Function of the Hypothetical Protein Encoded By Gene
Twenty-Two of the Makai Bacteriophage Genome
Chloe G Severson, Isabella AR Margerin, Chloe L Moore, Andrew R Barrows, Jake W Franco, Chelsee J Javier,
Kimberly A Lucero, Elizabeth R Madrid, Kennedy S Neustel, Kamalani Oshiro, Nainoa W Ornellas, Abby Wilcer,
Lauren H Vavra, Stuart P Donachie, Megan L Porter, Floyd A Reed, Sitara Palecanda, Rebecca A Chong
Of the eighty-nine genes in the sequenced Makai bacteriophage genome, we used BLAST and HHpred to define
sixty-four genes as coding for the function of “hypothetical proteins”. Due to the abundance of these proteins
with unknown functions, we decided to investigate the function of one of these hypothetical proteins. After
running the amino acid sequences of identified “hypothetical proteins” through SWISS-MODEL, we chose to
investigate gene twenty-two due to its complex protein structure. SWISS-MODEL also defined the protein’s
local and global quality estimates, coverage, and possible ligands. We ran the amino acid sequence through
protein structure prediction programs InterPro, Phyre2, and ProFunc. We then identified domains, repeats,
detailed signature matches, predicted GO terms, cellular components, and identified portions of gene twenty-
two for which one protein function had been determined with 99.9%-100% confidence. Using these tools, we
determined that the product of gene twenty-two in the Makai genome is involved in general catalytic activity
as a function of hydrolase enzymes. Evidence supports that the function of gene twenty-two’s product in the
Makai bacteriophage genome is that of a hydrolase enzyme. Based on the data available for other
bacteriophages, we determined that this catalytic activity involving hydrolase enzymes occurs in the tail region
of bacteriophage Makai and aids in the transference of DNA between virus and host.
107
11th Annual SEA Symposium Abstract
University of Ibadan
Ibadan
Corresponding Faculty Member: Olubusuyi Moses Adewumi ([email protected])
Cluster FE-like Bacteriophages infect a range of Bacteria and can be
lysogenic
Tolulope J Oduselu, Anjolaoluwa E Taiwo, Ifeoluwa E Ayodele, Oluwatimileyin T Oyebamiji, Nanayaa A Atoyebi,
Modupeoluwa C Omolola, Uchemadu F Lazarus, Adefola L Jose, Elijah M Akinlolu, Babatunde M Ojebola,
Olakunle S Olatinwo, Muideen K Raifu, Ini Adebiyi, Olatimbo V Ogunleye, Temitope O Faleye, Adeleye S
Bakarey, Olubusuyi M Adewumi, John I Anetor, Olusegun O Ademowo
Actinobacteria is a phylum of high G+C Gram positive bacteria with several members (e.g Mycobacterium
tuberculosis; the etiologic agent of TB) of economic importance. The recent upsurge in isolation and
characterization of Phages of Actinobacteria (Actinophages) is courtesy the SEA-PHAGES program and has
resulted in the isolation of over 15,000 Actinophages distributed into over 120 clusters, with the genomes of
over 2,000 already deposited in GenBank. Only three genomes exist till date for Cluster FE and are all from lytic
phages. In our effort to annotate Idaho (a member of the cluster), we stumbled unto anecdotal evidence that
Cluster FE phages lysogenize. Here we describe our findings.
Identification of sequences of putative Cluster FE Actinophage-related prophages was done by BLASTp search
of predicted Cluster FE phage proteins against the non-redundant protein database at NCBI. The Portal protein
(PP), Major Capsid and Protease fusion Protein (MCPFP) and Tape Measure Protein (TMP) sequences of Cluster
FE Actinophages were used as queries in the searches with default parameters. Recovered genomes were
further screened (using Artemis) for low GC islands that correlated with coordinates from the BLASTp search.
Confirmed low GC islands with Phage coding regions were then extracted. Subsequently, prophages were
independently auto-annotated using both DNAMASTER and the RAST server and annotations were visually
screened using both DNAMASTER and Artemis. Genome Maps were subsequently generated using
DNAMASTER. Amino acid similarity of the PP, MCPFP and TMP proteins was done using MEGA5. The structure
of TMP in all the ProPhages was predicted using ITASSER.
Significant hits spanning entire genomes were recovered from five Actinobacteria genomes belonging to genus
Cellulosimicrobium (2 prophages), Arthrobacter (3 prophages) and Microbacterium (1 prophage). Genome Size
ranged from 12.5kbp-16.5kbp. GC content ranged from 56.2%-70.5%. Genome organization was very similar
with structural genes in synteny and same with non-structural genes. Number of genes per genomes varied
from16-23. Across genes and genomes, overall nucleic acid sequence similarity was extremely low. Amino acid
similarity was also very low but higher than nucleic acid similarity. Despite significant amino acid diversity, the
TMP structure was absolutely conserved across all the genomes.
We describe six FE Cluster prophages in Actinobacteria genomes as evidence that these Phages infect a range
of Actinobacteria and have a lysogenic phase in their life cycle. We further show that though the genome
organization and protein structure of Cluster FE phages is relatively conserved, the sequence similarity,
genome size and number of genes vary.
108
11th Annual SEA Symposium Abstract
University of Ibadan
Ibadan
Corresponding Faculty Member: Olubusuyi Moses Adewumi ([email protected])
Olusegun G Ademowo
SEA-PHAGES 2018-2019 Session: The Ibadan Phage Hunters Experience
Olusegun G Ademowo, John I Anetor, Olubusuyi M Adewumi, Temitope O Faleye, Adeleye S Bakarey,
Olatimbo V Ogunleye, Ini Adebiyi, Muideen K Raifu, Tolulope J Oduselu, Anjolaoluwa E Taiwo, Ifeoluwa E
Ayodele, Oluwatimileyin T Oyebamiji, Nanayaa A Atoyebi, Modupeoluwa C Omolola, Uchemadu F Lazarus,
Adefola L Jose, Elijah M Akinlolu, Babatunde M Ojebola, Olakunle S Olatinwo
The University of Ibadan SEA-PHAGES team comprise of seasoned faculty members and selected 300 Level
Biomedical Laboratory Science undergraduates. The 2018 rookies embarked on a quest to isolate and identify
soil borne actinobacteriophages in the city of Ibadan. This attempt was however hampered by constraints
ranging from unavailability of isolation host, limited resources and disrupted academic calendar. These
constraints limited our capacity to isolate and characterize indigenous bacteriophages during the discovery
undergraduate research course offered in first semester. Nevertheless, during the genome annotation and
bioinformatic analyses second semester course we maximized the opportunity presented during the December
2018 Bioinformatics meeting. Knowledge gained at the meeting was imparted into our students and we
subsequently requested to annotate previously isolated Idaho Phage.
Within a short time, Idaho, a member of Cluster FE with a genome length of 15675 and an overhang sequence
of 15 bases and a total of 22 genome features was annotated by the team. It was a great opportunity to train
and see our undergraduates develop skills and show mastery in the use of variety of bioinformatic tools for
genome annotation. It is worth mentioning that in the course of annotation, we noticed that Cluster FE-like
bacteriophages including Idaho can be lysogenic and consequently showed 5 prophages with significant level
of identity in genome organization (Oduselu et al., 2019). Ultimately, we succeeded in our scientific quest and
today, with the assistance of the HHMI team, the annotated Idaho phage has been submitted to GenBank
under the accession number MK757448.
Going forward, the University of Ibadan SEA PHAGES team, with institutional support and cooperation of our
collaborators plan to annotate more bacteriophages, further explore our prophages experience, and more
importantly isolate and characterize indigenous bacteriophages from our region.
109
11th Annual SEA Symposium Abstract
University of Kansas
Lawrence KS
Corresponding Faculty Member: Rob Ward ([email protected])
Sonja Jost
Zoey Manz
Isolation and characterization of CV-cluster Gordonia bacteriophages
including JasperJr
Sonja Jost, Zoey Manz, Caleb Calhoun, Alexi Campidilli, Lexus Majors, Regan Putnam, Carlee Roberts, Shaelyn
Marr, Avery Roe, Sharyn Sebert, Robert Ward
The Gordonia phage JasperJr was isolated from a soil sample near the Pearson Scholarship Hall on the campus
of the University of Kansas in the fall of 2018. Plaque morphology indicated that JasperJr is a temperate phage,
and this was confirmed by making a JasperJr lysogen strain of Gordonia terrae in 2019. Sequence analysis
revealed that JasperJr is a member of cluster CV. The CV Cluster is mostly composed of temperate phages,
however, 8 different phams classified as immunity repressors have been found in the 29 CV cluster phages.
This raised the question of whether CV phages should be clustered based only upon whole genome sequence
similarity or whether CV should be subclustered based upon immunity. We therefore obtained additional CV
phages, made lysogens of the CV phage Carol Ann and the CY phage Pollux, and tested immunity of these
lysogens to a host of different temperate and lytic phages. Interestingly, CV cluster phages have been shown to
possess genes similar in structure to those coding for prophage-mediated defense systems in N cluster
mycobacteriophages. Though the functions of these CV cluster genes are poorly understood, their study may
provide valuable insight into phage defense systems. Thus targeting CV cluster phages for isolation would be a
convenient way to find additional genes for study. Using Phamerator, we found 4 genes that are highly
enriched in CV cluster phages and not found in other clusters. We designed PCR primers to amplify regions
between genes 12 and 13 and between genes 26 and 27 from JasperJr (and related phages). We found that
these primer sets efficiently amplified CV cluster phages but not phages from a variety of other clusters. We
could identify CV phages from a mixed phage sample having 10
5
excess of non-CV phages. We are attempting
110
to develop a protocol to use PCR to identify CV phages in enriched soil samples without filtering the
enrichment, thereby saving time and money. Finally, we were interested in identifying the JasperJr proteins
that were included in the infectious phage particles. We expected capsid, connector and tail proteins, but
hoped to identify if any of the proteins with unknown functions were also included. Ultimately, we had hoped
to use mass spectrometry, but were unable to get that far this semester. We did, however, make a large
volume of JasperJr high titer lysate that we purified through a cesium chloride ultracentrifuge gradient to
obtain a pure phage sample. We used polyacrylamide gel electrophoresis to separate phage proteins and
visualized them using Coomassie and silver staining techniques.
111
11th Annual SEA Symposium Abstract
University of Lagos
Lagos
Corresponding Faculty Member: Imade Nsa ([email protected])
Big3, a close relative of MrGordo
Emmanuella Omolade, Oyindamola Akinyemi, Kafayat Razaaq, Taiwo Ogunfile, Blessing Omolere, Maryam
Saliu, Habeeb Aderolu, Nzube Ekpunobi, Seun Bamisaye, Ayodeji Odunsi, Imade Nsa, Tenny Egwuatu, Ganiyu
Oyetibo, Matthew Ilori
Big3 is a siphoviridae phage isolated from an enriched soil sample in Richmond,VA by Brandon Brown-Ruffin at
Virginia Union University in 2016. Its genome was found to be 53442 bp in length and assigned to Cluster A,
subcluster A1. Programs used for annotation include DNA Master, NCBI BLAST Phamerator, Starterator,
GeneMark, HHPred and Gene Content Similarity (GCS) Tool. On annotation, we found 91 called ORFS, 49 had
known functions, the expected mosaic patterns in the gene order of sub-cluster A1, and no tRNAs. About 56%
were reverse genes, no orpham genes, 26% of the start sites began with GTG, 5.5% with TTG and others with
ATG. Big3’s annotation revealed a very strong resemblance to another temperate phage MrGordo isolated by
Sean Kearney at Purdue University. Using the GCS tool, Seventy-eight phams were common to both with a GCS
of 85.72% and fifty out of the 78 shared phams had the exact same ORF length. They were identical in their
gene sizes of their tape measure, Lysin B, portal, capsid maturation protease, integrase, endonuclease VII
proteins to name a few. They had the exact order of gene functions including the programmed translational
frameshift at the tail assembly chaperone except that MrGordo had a split primase, only one terminase, more
structural proteins but no superinfection immunity and helix-turn-helix binding domain proteins. On the other
hand, Big3 had more minor tail proteins, small and large terminase subunits and membrane proteins. In
addition, the largest ORF in Big3 was the large terminase subunit (2712 bp) followed by the tape measure
protein (2472 bp), whereas, for MrGordo, tape measure (2472 bp) was the largest.
112
11th Annual SEA Symposium Abstract
University of Louisiana at Monroe
Monroe LA
Corresponding Faculty Member: Ann Findley ([email protected])
Comparison of the Gordonia terrae CU3 Cluster Phage Dardanus with CU1
Cluster Members and the Singleton Phage Catfish
Breanna A Gottschalck, Hart A Bordelon, Ethan M Brister, Amanda M Bryans, Ashlynn E Calk, Christian C
Capers, Jacob M Corrent, Cecil N Delphin, Grant W Erbelding, Brandon T Hale, Nautica T Jones, Angelle R
Mire, Austin R Perkins, Rebecca D Quackenbush, Chelsi S Rogers, Nicholette C Stewart, Hannah N Threeton,
Zachary F Wiggins, Anne Marie Hancock, Aaron V Nguyen, Allison M D Wiedemeier, Christopher R
Gissendanner, Ann M Findley
During the 2017-18 academic year, ULM freshmen SEA PHAGES Program students isolated 24 novel
bacteriophages using the Gordonia terrae host system. Gordonia phage Catfish was sequenced and
determined to be a Singleton with no clear homology to any previously sequenced Gordonia phage. Catfish
has 46,888 bp with a 3’ sticky overhang of eleven bases, 79 open reading frames, and a GC content of 65%. In
functionally annotating the Catfish genome, highest BLAST hits for the entire genome and many of its
functional open reading frames (ORFs) corresponded to members of the CU1 cluster of Gordonia terrae
phages. We have since adopted Gordonia phage Dardanus for annotation (isolated by Florida Gulf Coast
University). Dardanus, the sole member of the CU3 cluster of currently-sequenced Gordonia phages, has
43,143 bp, 74 ORFs, no tRNA genes, a GC content of 66%, and shares many of its functional ORFs with
members of the CU1 cluster and Catfish. We provide a functional annotation of Dardanus and explore its
relationship to CU1 cluster Gordonia phages and the Catfish singleton using the SplitsTree, Gepard DotPlot,
and Phamerator visualization tools. Such analyses provide insight not only into the relationship between the
Gordonia terrae phages but can point to extended comparisons between other Actinobacter phage group
isolates.
113
11th Annual SEA Symposium Abstract
University of Maine, Farmington
Farmington ME
Corresponding Faculty Member: Tim Breton ([email protected])
Mikahla Searles
Discovery and analysis of Subcluter DE3 phage RoadKill from a
wastewater treatment facility
Mikahla Searles, Naomi Moulton, Liz Nadeau, Paige Ring, Jean A Doty, Timothy S Breton
Bacteriophages are useful tools in a variety of biomedical and molecular research studies, including efforts to
combat antibiotic resistance and understand both DNA recombination and protein function. A novel
bacteriophage able to infect Gordonia terrae was isolated from a wastewater treatment facility in Farmington,
Maine and named Roadkill. Roadkill is a siphoviridae phage that produced clear, round plaques and is member
of Subcluster DE3. RoadKill’s genome is circularly permuted and consists of 55,939 bp and 84 genes. Similar to
other Cluster DE phages, the RoadKill genome does not contain any well-established genes associated with
lysogeny, and may only exhibit lytic growth. RoadKill is highly similar to other DE3 phages (96-97% identity)
but also exhibits some novel recombination, including after the terminase gene and between genes 65 and 68.
These four genes were possibly inserted into a protein coding sequence with high similarity to orpham gene 69
in phage Dexdert. The central region of this protein in Dexdert (residues 104-141) exhibits similarity to the end
of orpham gp69 in RoadKill. In addition, the same residue (104) and terminal end of the protein is associated
with high similarity to orpham gp73 in phage GTE6. Overall, this genomic location in the DE3 phage genes may
be associated with high rates of insertion and may require further investigation.
114
11thAnnualSEASymposiumAbstract
UniversityofMaine,HonorsCollege
OronoME
CorrespondingFacultyMember:SallyMolloy(sally.dixon@maine.edu)
JessicaHayden
AndrewFournier
Astudyofphagewithattitudes:defensiveGordoniaphageSidiousand
MagicManandcrazyRhodococcusphageWhackandSleepyHead
JessicaHayden,EmmieBaillargeon,AlecBallinger,AlexBarrios,JackBeaulieu,AngelaBurke,JackBurnell,
JacobCote,MatthewCox,MorganCrapo,SamuelDeelsnyder,HopeDorr,TrevorDugal,AndrewFournier,
CaidenFraiser,RemiGeohegan,BenjaminGove,KeeganGray,HannaGriffin,KaitlynJodoin,NateJordan,
MarissaKinney,SarahLatario,SarahLow,VictoriaMayers,KyleMurawski,EvaNazim,ErikaPacheco,Jenn
Quezada‐Loja,ZekeRobinson,MattSeuch,GabbySpencer,DylanTaplin,MarcThibodeau,ZachWilliams,Ryan
Worthington,MelissaMaginnis,MelodyNeely,SallyMolloy
ThroughuseofmultiplebacterialhostsintheSEAPHAGESclassroom,UMHC,isolatedandsequencedtwo
singletonRhodococcusphageandsixnovelGordoniaphagebelongingtoclustersA15,CT,CZ7,DB,DC,andDU.
TwooftheGordoniaphage,SidiousandMagicMan,aretemperateandencodeviraldefensesystems.Sidious
isthesolememberofsubclusterCZ7.Itsgenomeis51,789bpinlength,hasaGCcontentof66.6%,and
encodes84putativegenes.SidioussharesanimmunityrepressorwithclusterCZ1phageBatStarrand
NymphadoraandG.terraelysogensofSidiousarehomoimmunewiththesephage.Sidiouslysogensarealso
immunetoinfectionbyphagethatdonothaverelatedimmunityrepressors:YeezyandBaxterFox(CZ3);
BetterKatz(DI)andSitar(DE1).ThisheterotypicimmunitymaybeduetoSidiousgenesgp41and40,which
encodeaputativeabortiveinfectionsystem,RexAandRexB,respectively.MagicManisaclusterDBphage
witha47,598bpgenomewith67%GCcontent.Thegenomeencodes70putativegenesincludinganintegrase
(gp37),immunityrepressor(gp38),andputativeBrnT‐liketoxin(gp35).Anobviousanti‐toxingenewasnot
identified;howevergp36isdivergentlytranscribedrelativetogp35andthegeneproducthasaC‐terminal
ribbon‐helix‐helixdomain,consistentwiththeantitoxinBrnA.RhodococcusphageSleepyHeadandWhackare
temperate,singletonphage.TheSleepyHeadgenomeis43,943bpinlength,has61%GCcontent,andencodes
67putativegenes,including37orphams.SleepyHeadencodesanimmunitycassettethatincludesareverse
orientedimmunityrepressor(gp40),apeptidase(gp39)andtyrosineintegrase(gp38).Thepeptidasehasa
strongHHPREDmatchtoImmAZn‐dependentpeptidasesandcouldfunctionasananti‐repressor.Thereare11
115
reversegenesbetweentheintegraseandtheminortailproteinsthatinclude2transposases,aribonuclease
andamembraneprotein.RhodococcusphageWhackhasa49,660‐bpgenomewith61.9%CGCcontent.Whack
isalsoasingleton,sharingonly25%ofits77putativegeneswithitsclosestrelative,singletonRhodococcus
phage,REQ2.NearlyhalfofWhack’sgenes(43%)belongtoorphams,includingtheimmunityrepressorand
tyrosineintegrase.Downstreamoftheintegraseare7reverseorientedgenesthatinclude3DNAbinding
proteins,2membraneproteinsandalipoprotein.
116
11th Annual SEA Symposium Abstract
University of Mary
Bismarck ND
Corresponding Faculty Member: Christine Fleischacker ([email protected])
Lorren Postl
Host range infectivity studies of three unique annotated phages, Jiminy
(B1), Doug (F1) and Malthus (K4) discovered in water and soil samples
near Bismarck, ND
Lorren Postl, Benjamin Ahlbrecht, Heidi Bau, Hope Bodnar, Casi Boehm, Zoe Fath, Madison Holm, Marina Lula,
Kylie Pastian, Joey Popiel, Joel Weisbrod, Frances Whitman, Joseph Angstman, Grace Burns, Micah
Zimmerman, Christine Fleischacker
The students in the Phage Discovery Research Course at the University of Mary discovered in the Fall of 2018,
three novel phages using Mycobacterium smegmatis mc2 155 as the host cell. This is the 3rd year of being a
part of the SEA Phages Program, which is sponsored by HHMI Science Education Division. The first phage,
Jiminy, was isolated from a water sample from the Apple Creek near the University of Mary and is a B1
subcluster phage. The second phage, Doug, was isolated from the garden soil of the University’s President and
is an F1 subcluster phage. The third phage, Malthus was isolated from soil near the University and is a K4
subcluster phage. Electron microscopy revealed all three phages to belong to the phage group of siphoviridae.
Jiminy had the largest genome with 68777 bp and GC content of 66.4%. Both Doug and Malthus had smaller
genomes, 58397 bp and 57802 bp respectively and GC content of 61.1% and 67.9% respectively. Further
investigation into the host range infection capabilities using different mycobacterium hosts for these phages
revealed interesting results. The three phages, despite being from different subclusters, had varying abilities
to infect multiple hosts. Their genomes were annotated in the Phage Genomic Analysis Research Course in the
Spring of 2019 and the host range infectivity results as well as the comparison of their genomes will be
discussed. These phages were tested using alternative mycobacterium hosts of Mycobacterium smegmatis,
Mycobacterium phlei, Mycobacterium nonchromogenicum, Mycobacterium fortuitum, Mycobacterium
chelonae and Mycobacterium marinum.
117
11th Annual SEA Symposium Abstract
University of Mary Washington
Fredericksburg VA
Corresponding Faculty Member: Lynn Lewis ([email protected])
Kayla N Botto
Phage Hunting at the University of Mary Washington
Kayla N Botto, Joseph D Callery, Kimberly M Corbett, Pamela D Daniels, Kaylee D Deardorff, Julia K Gasink,
Grace W Holcomb, Jack J Levine, Sean D Lockwood, Angus S Long, Madelynne E McIntosh, Gabrielle P Moore,
Natalie J Mroz, Rina Murasaki, Kaitlyn O Parker, Ty G Stephenson, Bennet T Varghese, Theresa M Grana, Lynn
O Lewis
UMW Phage Hunters classes have been isolating phages from Bacillus hosts since 2011. Our host this year was
B. thuringiensis subsp. Kurstaki, which has been used as microbial insecticide for pest control and is used as
a
simulant for Bac
illus ant
hracis in biowarfare/bioterrorism studies. Of the 17 phages isolated this year, two
(Grumio and FreightTrain) were sequenced. Both were isolated from enriched cultures, both were myoviruses,
and Grumio was found
in soil f
rom Woodbridge, VA, while FreightTrain was isolated from soil collected in
Fredericksburg, VA. Grumio has a genome length of 161,495 bp, which autoannotated with 294 features, a
direct terminal
repeat of 2,585 bp, and a GC content of 38.7%. Grumio is most similar to Archie14, ALPS and
Rex16 by BLAST. FreightTrain has a genome length of 162,107 bp, which autoannotated with 297 features,
a
direct terminal repeat of 2,823 bp and a GC content of 38.7% and is most similar to DIGNKC, Zuko and
AaronP
hadges. Neither phage contained any tRNA genes when searched with tRNA Scan. A host range study
was con
ducted with Grumio, demonstrating that it could infect both B. subtilis and B. anthracis Delta Sterne in
addition to B. thuringiensis. Both phages belong to subcluster C1.
118
11th Annual SEA Symposium Abstract
University of Maryland, Baltimore County
Baltimore MD
Corresponding Faculty Member: Steve Caruso ([email protected])
Michelle L Guldan
Of clusters and mischief: the Streptomyces phageome
Kristina E Atanasoff, Ashley Batista, Courtney L Colson, Gregory Furletti, Stephen Goralski, Michelle L Guldan,
Matthew S Kane, Jenni Kelleher, George Kyaw, Sarah V Lance, Dorjan Leka, Shirin Ludwig, Victoria Mahaney,
Phoebe Mariano, Tanzeem Naqvi, Thomas O'Brien, Sana Rana, Chih Shiang K Shee, Andrew L Simpson, Shreya
Singh, Ryland N Spence, Racheal A Spruill, Lowen E Wachhaus, Claudia L Xie, Ivan Erill, Steven M Caruso
The 2018 UMBC Phage Hunters successfully isolated, characterized and sequenced the genomes of six
bacteriophages infecting two hosts: the phytopathogenic Streptomyces scabiei and heavy metal-tolerant
Streptomyces mirabilis. Five of the phages are Siphoviridae, including: two BB2 phages, Heather and
RemusLoopin; a BG phage, Mischief19; a BI2 phage, PherryCruz; and a singleton, RosaAsantewaa (accession
numbers MK686069-MK686072). The sixth phage, Forthebois, is a Tectiviridae and is in cluster BO (accession
number MK620900). Analysis of the annotated genomes with Phamerator, Geppard plots, and the Gene
Content Similarity (GCS) metric revealed that the cluster assignment for some of these phages may need to be
revised. For instance, RosaAsantewaa is currently classified as a singleton, but shares 60% GCS with subcluster
BI2. Conversely, re-assigning Mischief19, currently annotated as a BG phage, as the first member of subcluster
BG2 would significantly decrease the dispersion of GCS values within cluster BG. To gain further insight into the
accuracy of these putative reassignments, we explored the use of two highly conserved structural genes (those
coding for the tape measure and terminase proteins, often syntenic) for phylogeny-based cluster assignment.
The tape measure protein (TMP) generates noisier Gepard plots than the terminase protein due to the
presence of internal repeats, limiting its applicability for clustering purposes. Further analysis enabled us to
identify the repeat motifs in several clusters, and phylogenetic analysis also confirmed that repeats have an
impact on alignment and subsequent tree inference. Using the tree distance for clustering, we observe that
the results essentially recapitulate the established clusters, with some notable exceptions. Most notably, the
TMP of Mischief19 bears little resemblance to that of its assigned cluster, supporting again that Mischief19
should probably define its own subcluster BG2. This phage displays a large insert between its capsid and tail
fiber genes and almost half its genome is composed of orphams. Our bioinformatic analysis also detected the
presence of a predicted protein in RosaAsantewaa with a partial match to the coliphage superinfection
exclusion protein B (PF14163). This predicted protein appears to be conserved among BI phages, which have
been consistently annotated as lytic. Examination of the BB2 subcluster, including phages Heather and
RemusLoopin, revealed a high degree of conservation in this subcluster and the likely acquisition of a thyX
gene in one of the subcluster phages (Sebastisaurus). We discuss the possible role of superinfection exclusion
proteins in lytic phages, and of thymidylate synthases in lysogenic ones.
119
11th Annual SEA Symposium Abstract
University of Nebraska-Lincoln
Lincoln NE
Corresponding Faculty Member: Catherine Chia ([email protected])
Phoebe B Peña
Isolation of phage that infect Gordonia rubripertincta and annotation of
Gibbous and Chikenjars
Phoebe B Peña, Lindsay R Birge, Layton D Bivans, Seth M Blakestad, Emma K Chesley, Elizabeth E Frank, Sarah
Hoagland, Justin Hultquist, Ethan P Ramsey, Nicholas R Lee
The Gordonia genus includes species capable of transforming and degrading hydrocarbons, making them
candidates for environmental and industrial biotechnology (Arenskötter, et al., 2004). Phages of Gordonia are
potential genetic tools that can be used to study the genes coding for the metabolic enzymes of the bacteria.
To bolster the numbers of identified phage that infect the genus Gordonia (currently ~ 1600), students used
Gordonia rubripertincta NRRL B-1654 as the host in the Fall 2018 Virus Hunting course at UNL. By direct
isolation, six phage were successfully acquired, archived and added to The Actinobacteriophage Database
(phagesDB.org). All six phage are siphoviridae as judged by their morphology viewed by transmission electron
microscopy, having tails ranging in length from 200 to 250 nm. Two genome sequences, Gibbous (45,810 bp;
60.5% GC) and Chikenjars (61,544 bp; 51.3% GC) were determined by Illumina Sequencing by the Pittsburgh
Bacteriophage Institute. Auto-annotation using DNA Master predicted 69 genes in Gibbous (cluster CT) and 95
genes in Chikenjars (cluster DJ). An obvious difference between the phage genomes, based on the auto-
annotation, was the presence of 24 reverse ORFs in Gibbous clustered largely in the right arm of its genome,
while Chikenjars has only four small reverse ORFs that are isolated and dispersed through the genome.
Phamerator analyses showed that the two phages shared no Phams although both had the requisite known
proteins of tailed phages including terminase, HNH endonuclease, portal protein, capsid maturation protease,
scaffolding protein, major and minor capsid proteins, endolysins, major and minor tail proteins, and tape
measure protein. Very close relatives of Chikenjars, phages Duffington and Rickmore, (cluster DJ), were
isolated in Idaho using Gordonia terrae 3612 as the host, raising the interesting questions of whether they can
infect G. rubripertincta and if Chikenjars can infect G. terrae. Similarly, phages Cozz and Emalyn (cluster CT),
identified using G. terrae as the host, are relatives of Gibbous. The same question arises as to whether the
phages can cross infect the other Gordonia species. Annotation by the class group found support for functional
assignments of 31 out of 69 genes (45%) for Gibbous. For Chikenjars, 19 out of 95 ( 20%) of the genes had
credible support for functional predictions.
120
11th Annual SEA Symposium Abstract
University of Nevada Las Vegas
Las Vegas NV
Corresponding Faculty Member: Philippos Tsourkas ([email protected])
Ryan Doss
Cluster A1 and Cluster J Mycobacteriophages with Possible Homologous
Putative Beta-Lactamase and Putative Superinfection Immunity
Repressors
Ryan Doss, Kurt Regner, Christy Strong, Philippos Tsourkas
We present the genomes of Mycobacterium smegmatis phages NihilNomen and Carlyle, isolated by students
at the University of Nevada Las Vegas. The phages were isolated from compost in the University community
garden. Both phages are temperate.
NihilNomen is a cluster J phage with a genome 110,439 base pairs long and GC content 60.8%, typical of
cluster J phages. Its genome ends are 3’ sticky overhangs 4 bp long. We identified 240 genes, including one
tRNA.
Carlyle is a cluster A1 phage with a genome 51,220 base pairs long and GC content 63.6%, also typical of
cluster A1 phages. Its genome ends are 3’ sticky overhangs 10 bp long. We identified 91 genes in Carlyle, with
no tRNAs. There was a population of unusual reads around position 29100 in Carlyle’s genome, indicating that
it could perhaps be two very closely related phages, or that there is a large mutant population in the sample.
NihilNomen appears to possess a third terminase (gp2), located upstream of the small and large terminase. It
corresponds to what other researchers of cluster J phages report as a possible DNA-packaging protein.
NihilNomen also contains a putative pbp beta-lactamase gene at gp39 and a putative superinfection immunity
repressor at gp196. These three genes will be investigated further during the summer.
In Carlyle, the small terminase (gp4) is not adjacent from the large terminase (gp13), with the lysin A (gp11)
and lysin B (gp12) located in between. Carlyle also contains a putative pbp beta-lactamase gene (gp34), with
60% amino acid sequence identity match with the beta-lactamase in NihilNomen, as well as a putative
superinfection immunity protein (gp74) with a 98% amino acid sequence identity match with that in
NihilNomen. The putative beta-lactamase and superinfection immunity protein of Carlyle will be investigated
this summer along with those of NihilNomen.
121
11th Annual SEA Symposium Abstract
University of North Georgia
Dahlonega GA
Corresponding Faculty Member: Alison Kanak ([email protected])
Kandice Cantrell
Environmental Effects on Mycobacteriophage Cepens - Host Interactions
Kandice Cantrell, Ethan Strickland, Ryan Shanks, Alison Kanak
Bacteriophage (phage) are viruses that infect and use bacterial hosts for viral replication. Study of these
bacterial viruses has led to such discoveries as knowing DNA is the molecule of inheritance. Study of phage has
also led to discovery and implementation of novel therapeutic treatment of infections. Known as “phage
therapy”, phage have been utilized in curing a patient of the highly virulent infection known as MRSA.
Tuberculosis, caused by Mycobacterium tuberculosis, is a growing concern as more antibiotic-resistant strains
become more prevalent in the population. Cepens is a lytic phage that infects members of the Mycobacterium
genus. This study analyzes Cepens and its interactions with its host bacteria, Mycobacterium smegmatis, in an
effort to understand how environmental conditions impact infection and replication efficiency. First,
replication benchmarks were established by conducting a serial dilution and plaque assay under standard
conditions. Baseline titer calculations were used for comparison after alteration of incubation temperature and
pH of phage, both prior to and during infection. To determine the ability to withstand thermal exposure during
infection, plated samples were incubated between 25°C-50°C. To test the effects of pH on infection, samples
were titered on plates ranging from pH of 5.0-8.1. Thermal stability of phage lysate was determined after
exposure to 37°C-65°C. Lastly, pH stability of phage lysate was also tested by exposing sample to a pH range of
1.0-10.0. Extreme temperatures and pH are expected to lead to a decrease in infectivity as well as potential
degradation of the phage itself. The effect of variation in environmental conditions was shown through
analysis of plaque presence, size, and number. Analysis of this data provides optimal conditions for maximum
host infectivity and further contributes to the understanding of virus-host interactions.
122
11th Annual SEA Symposium Abstract
University of North Texas
Denton TX
Corresponding Faculty Member: Lee Hughes ([email protected])
Brendon Williams
Examination of Orphams following the Tape Measure of Streptomyces
phage Celia, the first member of Subcluster BD6
Brendon Williams, Julia Lopez, Katherine N Ball, Lee E Hughes
Streptomyces phage Celia was isolated on the host Streptomyces xanthochromogenes NRRL B-5410 in 2018 at
the University of North Texas. Celia was sequenced at the University of Pittsburgh and found to be the first
member of subcluster BD6. UNT students annotated the genome in the spring semester of 2019. Of Celia’s 80
genes, 22 were found to be orphams, including a small region consisting of four genes in the region just after
the tape measure gene. This region, which is expected to contain minor tail proteins, has been examined in
other BD phages where a variety in both numbers of genes and the phams the genes belong to has been
found. We are comparing Celia's genome with these other phages in order to better understand the
implications of the orphams found in this region of Celia's genome.
123
11th Annual SEA Symposium Abstract
University of the Ozarks
Clarksville AR
Corresponding Faculty Member: Sean Coleman ([email protected])
Gracie J Millar
Indentification and Annotation of Gordonia Phage Avazak
Gracie J Millar, Adolfo Sotolongo
Antibiotic resistance in bacteria is a developing issue, that will continue to spread as bacteria adapt to current
therapies. One possible solution to this issue is phage therapy. Phage therapy uses bacteriophages, viruses
that only attack bacteria, to infect specific pathogenic bacteria. Recently, this has been used as a therapy of
last resort. The demand for new phages and their classification has opened access to research and discovery
for undergraduate students through the SEA-PHAGES program. Only a small percentage of estimated phages in
our biosphere have been discovered and annotated. Researchers are striving to unearth more bacteriophages
in order to understand their structure, function, ecology, and potential use in treating infections caused by
antibiotic resistant bacteria. Through established protocols a phage, Avazak, was discovered, isolated, and its
genome annotated. Avazak infects the bacterium Gordonia rubripertincta. G. rubripertincta is a soil bacterium
of the phylum Actinobacteria and is gram-positive. Avazak is a cluster DJ phage which has 14 other known
family members, who are Siphoviridae and have lytic life-cycles. Avazak forms small definite plaques and has
91 genes in its genome. Continued identification and characterization of novel bacteriophages will provide
increased understanding of phages and may aid against antibiotic resistant bacteria.
124
11th Annual SEA Symposium Abstract
University of Pittsburgh
Pittsburgh PA
Corresponding Faculty Member: Marcie Warner ([email protected])
Swathi Tata
Investigating Gordonia terrae phages for the presence of prophage-
mediated host defenses
Swathi Tata, 2018-2019 Pitt SEA-PHAGES Course, Meghan Bechman, Rebecca Bortz, Kristen Butela, Brenda
Hammer, Marcie Warner, Matthew Montgomery, Deborah Jacobs-Sera, Graham F Hatfull
The collection of over 15,000 actinobacteriophages, with 2,900 of these being sequenced, can reveal insights
into phage diversity and evolution. The 2018-2019 student cohort of phagehunters at the University of
Pittsburgh isolated 198 phages from environmental samples using the host Gordonia terrae 3612, contributing
to the overall total of over 1,500 phages isolated on Gordonia hosts. The genomes of 19 of these phages were
sequenced, adding to the existing collection of 379 sequenced Gordonia phages. These phage genomes are
characteristically mosaic and span considerable genomic diversity, being assigned to 8 extant clusters (CS [4],
CT [1], CV [1], CZ [5], DB [1], DC [2], DE [4], and DP [1]). One sample yielded two fully sequenced phages (JajaA
[Cluster CV] and JajaB [Cluster CS3]) that we purified, separated, assigned to cluster using PCR, and annotated.
Additional phages previously isolated by Pitt students in years 2016-2018 were annotated and assigned to 5
clusters (CV [2], CZ [3], DB [1], DC [1], and DN [2]). Phages isolated during the 18-19 academic year differ in
genome length ranging from 46,096 bp (HannahD, Cluster DB) to 114,220 bp (Boopy, Cluster DS), and G+C%
content, ranging from 50.1% (Ziko, Cluster DP) to 67.6% (Bakery, Cluster DC; G. terrae is 67.8%). Several
temperate G. terrae phages in our collection display genetic mosaicism in the area immediately surrounding
the immunity cassette, similar to what has been previously reported for the Cluster N mycobacteriophages.
Such genes are candidates for novel prophage-mediated viral defense mechanisms. To investigate this
possibility, previous students in the Pitt SEA-PHAGES course created a collection of G. terrae lysogens using
Blueberry (Cluster CV), Utz (Cluster CV), UmaThurman (Cluster CV), Lilas (Cluster CY1), Vasanti (Cluster CZ2),
Adora (Cluster CZ4), and Opie (Cluster DB). We tested a collection of over 100 sequenced and unsequenced
phages for their ability to infect these lysogens, and preliminary data shows that these lysogens defend against
infection from various phages, with plating efficiencies reduced by at least 10
-4
relative to the wild-type G.
terrae host. Future directions include identifying candidate genes that could confer defense against
superinfection in the lysogens we tested this year, generating lysogens from newly annotated temperate
phages that show genetic mosaicism near the immunity cassette, sequencing the phages against which the
various prophages tested here provide protection, and investigating lysogen gene expression and the phages
they defend against.
125
11th Annual SEA Symposium Abstract
University of Puerto Rico at Cayey
Cayey PR
Corresponding Faculty Member: Edwin Vazquez ([email protected])
Nayid E Jana-Martinez
Genomic comparisons of a set of diverse bacteriophages isolated from
Puerto Rico
Nayid E Jana-Martinez, Bonmarie Pedraza-Lopez, Denniel A Rosado-Nunez, Hector N Romero-Soto, Alondra
Rivera-Cruz, Miosotty Aleman-Lozada, Fabiola Aponte-Olivieri, Ines N Aviles-Rivera, Hector Cartagena-Torres,
Maria A Cruz-Velazquez, Samira J Diaz-Dingui, Bryan J Diaz-Melendez, Noelis Falcon-Lizardi, Nectar G Gonzalez-
Negron, Karian A Martinez-Pagan, Valerie V Medina-Santiago, Andres S Millan-Laboy, Perla M Miranda-
Melendez, Charlie Mercado-Mulero, Lizmary Morales-Diaz, Sophia L Negron-Caez, Robert J Nieves-Ayala,
Maricelys Ortiz-Castro, Keishlean M Osorio-Medina, Kathya M Reyes-Laureano, Adriana Reyes-Soto, Yanidelis
Rios-Rosa, Alondra Rivera-Cruz, Nicole S Rivera-Espinal, Edgar J Robles-Arocho, Fabian E Rodriguez-Cotto,
Cynthia M Rodriguez-Cruz, Kevin I Rodriguez-Otero, Andrea N Rosa-Flores, Eliomar Rosa-Ramon, Janely M
Rosa-Vazquez, Gabriel Rosario-Ortiz, Alondra Rosario-Valdes, Gabriela V Seda-Alvarado, Juan A Vargas-Alvarez,
Alondra Vargas-Lopez, Joe A Vazquez-Valentin, Roberto J Herrera-DelValle, Joelis M Lama-Diaz, Carlos E
Ocasio-Caldero, Priamo A Pichardo-Gonzalez, Jose O Silva-Martinez, Mariceli Fernandez-Martinez, Michael R
Rubin, Edwin Vazquez
The rich diversity of Puerto Rico´s ecosystems is reflected in the variety of bacteriophages isolated during the
ten years of participation of our institution in the SEA-PHAGES Program. We have isolated hundreds of
different phages of which the genomes of 32 have been sequenced. These include twenty-one
mycobacteriophages, ten Gordonia terrae phages, and one Microbacterium phage. We have streamlined the
standard protocols to save time, effort and materials, without sacrificing the pedagogical aspects of the hands-
on experience, and the deep-conceptual understanding of the biological processes involved. We now report
on the isolation, characterization, genomic annotation and comparison of five novel Gordonia phages (Yndexa,
Sukkupi, Syleon, MelBins and Keelan) and one Microbacterium phage (Zanella). We have compared their
genomes in terms of the gene homology of various highly conserved regulatory and structural genes, and the
divergence of others that have apparent essential functions but have probably not been submitted to the
same natural selection pressures of the conserved ones. Among the genes studied are DNA-binding, tape
measure and capsid proteins, and lysins. Three of the seven CR cluster Gordonia phages in PhagesDB are from
Puerto Rico (BiPauneto, Sukkupi and Yndexa). Genome comparisons show that Sukkupi and Yndexa are highly
similar, with a few sequence differences on both the left and right ends, indicating a very recent evolutionary
divergence from a common ancestor. MelBins is a DE2 cluster phage and Keelan is from cluster DP, again
126
denoting the diversity of the phages isolated. Zanella, the Microbacterium phage, has the smallest genome
size, at 42,108 bp, which is reflected in its short-predicted tail length based on the number of amino acids
comprising the tape measure protein, at only 45 nm versus 325 nm for Syleon. Our results contribute to
understanding the enormous genetic diversity of bacteriophages and the underlying similarities that point to
their common evolutionary origin.
127
11th Annual SEA Symposium Abstract
University of the Sciences in Philadelphia
Philadelphia PA
Corresponding Faculty Member: Dana Pape-Zambito ([email protected])
Colin Bokan
West Philadelphia Born and Phaged
Sadia Ali, Carmen Biniek, Colin Bokan, Justin Derk, Allie Hushen, Zeina Issa, Jack Kisielius, Sarah Macko, Taylor
Pompan, David Tomlinson, Abigail White, Dana Pape-Zambito
Bacteriophages are the most abundant organism in the biosphere. Approximately eighty percent of phage
genomes lack known functions making phages prime candidates for experimental research. Furthermore, little
information is available on bacteriophages that infect Microbacterium foliorum, thus this host was selected for
bacteriophage isolation. Phage PhillyPhilly was recovered and isolated from a soil sample just outside the
University of the Sciences in the heart of West Philadelphia. PhillyPhilly was sent to be sequenced within a
DOGEMS pooled sample. Using PCR it was then verified to belong to the ED cluster, and shares a majority of
its characteristics with nine other ED1 subcluster phages. Its genome is 62,869 base pairs long with 119
putative genes. PhillyPhilly has a genome end characterized as a direct terminal repeat consisting of 3,380
base pairs, where genes 1-8 align with 112-119, respectively. PhillyPhilly has the ability to lyse the bacterial
host and lacks an integrase gene, which led to the conclusion that it follows the lytic life cycle. Expanding upon
gene functions it was also discovered that PhillyPhilly contains a RuvC-like resolvase, which is key in genetic
recombination. This could gene could be essential in understanding how these phages change and evolve.
Interestingly, PhillyPhilly acquired a set of three genes that are common among all ED2 cluster phages, but are
only found in half of the ED1 cluster phages. These findings have helped us better understand what our phage
is and how it interacts within its environment.
128
11th Annual SEA Symposium Abstract
University of South Florida
Tampa FL
Corresponding Faculty Member: Richard Pollenz ([email protected])
Louis Otero
Relationships of Genome Length, Capsid Size, Tape Measure Protein, Tail
Length and Functional Gene Calls Across Multiple Phage Clusters
Alexandra Rodier, Louis Otero
Genome sizes in actinobactrtiophages range from 14,270bp to 235,841bp. Actinobactrtiophages also have
three different morphologies: siphoviridae, myoviridae, and podoviridae, all typically characterized by tail size.
This research investigated several relationships: 1) genome size to capsid size; 2) tape measure protein size
compared to tail size; 3) genome size to function gene calls; and 4) genome size compared to functional gene
calls with structural proteins. Five clusters were utilized that varied in genome size: Cluster C (C1) (154,830 bp),
Cluster J (110,185 bp), Cluster E (75,874 bp), Cluster AK (43,397 bp), and Cluster AN (15,547 bp), and 10 phages
from each were evaluated. EM images were used to measure the diameter and volumes of the capsid and
determine the length of the tail. The genes list was evaluated for function and classified as structural proteins,
enzymes, or regulatory proteins. T tests were used to determine statistical significance between the different
measurements and regression analysis used to determine correlations. The results show that there is a
significant correlation between capsid size and genome volume/length. From the 50 phages evaluated, the
phage, Dandelion from Cluster C (C1) has the largest genome with a capsid size of 100 nm compared to 25 nm
for the phage, Toulouse (AN) with the smallest genome. The length of the measure protein also correlates to
tail size. The phage, BAKA, found in Cluster J has the longest tape measure protein with a tail size of 240 nm,
while Hunnie is one of the phages with the shortest tape measure protein with a tail size of 71 nm. When
relating genome size to the percentage of called functions, there is only a relationship between certain
clusters. Clusters C (C1), J, and E have an average percentage of called functions of 21%, 24%, and 22%, even
though the genome sizes range from 75kbp to 154kbp. However, the percent of called genes is statistically
significant when these clusters are compared to Cluster AK and Cluster AN due to an average percentage of
called functions of 42% for Cluster AK and 61% for Cluster AN. The data also show that as the genome size
increases, the percentage of called-functional genes with structural proteins decreases. For Cluster AN, the
average percentage of called-functional genes with structural proteins is at 75% compared to about 35% in
Cluster C (C1). This research supports an evolutionary relationship between genome size and the size of the
capsid. Future research might explore whether there are also differences in the size of capsid proteins and how
the capsid is assembled. The data show that the most compact genomes have a high number of called genes of
129
which the majority encode structural proteins. This raises the question regarding why a phage would evolve
with a genome that can be up to 10—times larger and what functions exist for the high percent of uncalled
genes in one of these phage.
130
11th Annual SEA Symposium Abstract
University of South Florida
Tampa FL
Corresponding Faculty Member: Richard Pollenz ([email protected])
Richard S Pollenz
Big Things in Small Packages: EK2 Cluster Actinobacteriophage Akoni and
Analysis of its “Super Gene”
Alexis Bailey, Richard S Pollenz
Analysis of phage from every cluster show that the longest genes are typically tapemeasure and very few
encode proteins >2000aa. Akoni is a cluster EK2 podoviridae actinobacteriophage that has a 54,307bp genome
containing 55 genes. Gene #31 is the first gene in the forward direction and it is a 13,464bp ORF (nearly 25% of
its genome) coding for a protein of 4487aa making it the largest gene ever found in a phage. There are 5 EK1, 2
EM and one other EK2 phage that are also podoviridae and contain a >13,000bp gene in the same location. The
goals of this project were to 1) search the bioinformatics databases to determine if other phage expressed a
similar protein, and 2) determine if the protein product of gene #31 could be detected within a purified
population of Akoni. A standard NCBI BLASTp analysis did not detect any significant hits, however, using PSI-
BLAST (Position-Specific Iterative Basic Local Alignment Search Tool), revealed low identity hits to virion RNA
polymerase (vRNAP) from E. coli phage Pollock and other N4-like phage. Analysis showed that 1) all of the
phage encoding the vRNAP were classified as podoviridae, 2) the vRNAP gene was the first gene in the reverse
or forward position, 3) the vRNAP gene encoded a very large protein of ~3,500 amino acids and 4) the vRNAP
proteins did not contain cystine. Although compelling, 3D modeling, HHPred analysis and secondary structure
predictions with different regions of gene #31 protein and vRNAP did not reveal any significant similarities
between the two sequences. vRNAP is predicted to be associated with the capsid and responsible for early
gene transcription. To determine if the gene #31 protein could be detected in Akoni, 20-25ml of high titer
Akoni lysate was centrifuged, concentrated in <300ul, subject to several rounds of sonication to disrupt the
phage and processed for SDS-PAGE or digested with trypsin for proteomic analysis using GC/MS. Proteomic
results show that the gene #31 product was detected with high intensity spanning 52 different peptides. The
coverage of gene #31 ranged from amino acid 62 to 4303 suggesting that the entire protein was translated.
The products of genes #32-37 were also detected as were #40-46. The majority of genes in this region did not
have many functional calls, but were predicted to be structural and included the portal protein (#32) and
several minor tail proteins (#35-37). SDS-PAGE results of coomassie stained gels have not yet shown a high
molecular mass protein that migrates above the 250kDa molecular mass marker but do show an intense band
that migrates at ~60kDa. Gene #33 encodes a 555aa protein (60kDa) and it is possible this may be a capsid
protein. These studies validate that the gene #31 product is a component of the intact phage particle. Future
research will be important to determine the precise function of the protein. It is intriguing to speculate that
this unique protein may be an actinobacteriophage version of the vRNAP.
131
11th Annual SEA Symposium Abstract
University of Southern Mississippi
Hattiesburg MS
Corresponding Faculty Member: Dmitri Mavrodi ([email protected])
Savannah Underwood
Functional analysis of conserved hypothetical genes in the cluster K
bacteriophage Hammy
Savannah Underwood, Amber Coats, Sara Dao, Grace Dittmar, J.C. Gardner, Taylor Gore, Taiya Jarva, Kathleen
Johnson, Giorgi Kenkebashvili, Sudiksha Kumar, Jasmine Ransom, Gabriella Reyes, Chazmyn Riley, Daniel
Sinclair, Breanna Smith, Audra Thompson, Garrett Watts, Victoria Williams, Clint Pablo, Danielle Heller*,
Viknesh Sivanathan*, Dmitri Mavrodi
* Howard Hughes Medical Institute, Chevy Chase MD
The genus Mycobacterium encompasses diverse saprophytic and commensal species, as well as serious
pathogens such as M. tuberculosis and M. leprae. Bacteriophages play a crucial role in the evolution of
mycobacteria and provide insights into the genetics and physiology of this economically important group of
organisms. Mycobacteriophages also attract a lot of recent interest as potential therapeutic agents for the
treatment of multidrug-resistant tuberculosis. To date, over 1,700 bacteriophages that infect Mycobacterium
were characterized through genome sequencing and grouped into 29 clusters based on genetic similarity. In
addition to well-characterized genes that encode structural, regulatory, DNA metabolism, and lytic proteins, all
mycobacteriophages genomes carry numerous conserved hypothetical genes. The specific functions of these
genes remain unknown, and only a few proteins have been expressed and studied experimentally.
In this study, we performed a functional analysis of Hammy, a K cluster mycobacteriophage with a 62-kb
genome that encodes 95 predicted protein-coding genes. Fifty of these genes are homologous to viral proteins
of known function, while the role of the remaining 45 genes is currently unknown. We employed a
combination of high-fidelity PCR and Gibson assembly to clone 81 Hammy gene into the broad-host-range
plasmid vector pSMEG-ExT (85% overall success rate). The resultant recombinant plasmids were
electroporated into M. smegmatis mc
2
155 and screened for cytotoxicity in the presence of the inducer
anhydrotetracycline. The screen identified several cytotoxic genes, which are variably present in members of
the K cluster (immediate relatives of Hammy) and other phages that infect Mycobacterium and Gordonia. Four
cytotoxic genes (32, 34, 50, and 56) were subjected to bacterial two-hybrid analysis to identify the host
proteins targeted by Hammy. The two-hybrid analysis identified several M. smegmatis proteins targeted by the
132
cytotoxic gene 56. One of these targets, malate synthase, was previously identified during the two-hybrid
analysis of bacteriophage ϕKMV and Pseudomonas aeruginosa. Results of this study will help to elucidate the
role of poorly characterized viral genes in the biology of phages that infect M. smegmatis, M. tuberculosis, and
closely related bacteria.
133
11thAnnualSEASymposiumAbstract
UniversityofTexasatElPaso
ElPasoTX
CorrespondingFacultyMember:GermánRosas‐Acosta(grosas3@utep.edu)
LizbethCarmona
SomethingwithBossLady
LizbethCarmona,JoathanBonglo,EvelynCohen,DevinMoreno,MonicaPonce,DanteReyna,AlheliRomero,
AndresVasquez,StephenAley,GermánRosas‐Acosta
Thesurgeofantibiotic‐resistantpathogenicbacteriahasdriventhesearchforalternativeapproachestotreat
bacterialinfectionsandovercomethisurgenthealthcarechallenge.Actinobacteriaphagesarepromising
candidatesforthisrole,giventheirabilitytokillimportanthumanbacterialpathogenswhilebeingharmlessto
humans.Tocontributetothisresearcheffort,weattemptedtheisolationofnovelArthrobacterphagesfrom
ourlocalenvironment.However,afterusingtheenrichmentmethodwith24differentsamples,wefailedto
isolatenewArthrobactersp.phagesfromtheElPasoregion,probablyduetotheparticularlydryconditionsof
the2018fallintheChihuahuandesert.Thus,forthegenomicannotationcomponentofthecourse,ourUTEP’s
PhageHunterteamwasassignedthephageBossLady,isolatedfromGermantown,MD.,bytheHowardHughes
MedicalInstitute.BossLadyhasa51,178bp‐longcirculargenomecodingfor79genes,72intheforward
directionand7inthereversedirection.Oneofthereverse‐orientedgenesislocatedinanisolatedposition
nearthe5′end,atraitsharedbymostothermembersoftheAO2subcluster.OurannotationofBossLady’s
genomicsequencerevealedanimportantdiscrepancywiththephagemorphologydatainthePhagesDB
database.Thisledustore‐examinethemorphotypesandapprovedfunctionsassignedtosomeoftheshared
genesacrossmembersoftheAO2subcluster.Atthemorphologicallevel,wefoundthatBossLadyandAO2
subclustermemberBarretLemonaremorphologicallyclassifiedSiphoviridaeeventhoughtheirgenomes
containgenescodingforTailSheetandTailTubeproteins,whichareexclusiveofphagesdisplayingMyoviridae
morphology.ConsideringthatBossLadyandBarretLemonexhibitclosegenomicassociationtoallmembersof
theAO2subcluster,thatallAO2phagesforwhichelectronmicroscopyimagesareavailableexhibitMyoviridae
morphology,andthatnoelectronmicroscopydataisavailableforBossLadyandBarretLemon,weproposethat
theyshouldbereclassifiedasMyoviridae.Atthegenomicannotationlevel,wefoundthatgeneproduct12
(gp12)showedextensivesequenceidentitywithsimilarlypositionedgenesofmostAO2subclusterphagesand
thatsuchgeneshadbeenfunctionallyidentifiedashead‐to‐tailconnectorproteins.However,HHPRED
analysesshowedthatBossLady’sgp12,justlikeallotherBLAST‐matchinggenesanalyzed,lackedtherequired
sequencerelatednesswithSSP1gp15orSSP1gp16,whichwouldjustifytheirfunctionalassignmentashead‐
to‐tailadaptororhead‐to‐tailstopperrespectively.Thus,wedidnotassignthehead‐to‐tailconnectorfunction
togp12andproposethatsuchfunctionshouldbeeliminatedforsimilarlylocatedgenesofmembersofthe
AO2subcluster.Ouranalysesindicatethat,asourknowledgeofthefunctionalpropertiesofphage‐encoded
genesincreases,substantialrefinementofpreviousgenomicannotationswillbeneeded.
134
11th Annual SEA Symposium Abstract
University of West Alabama
Livingston AL
Corresponding Faculty Member: Kayla Fast ([email protected])
Anna E Morse
Grabbing A1 phages by the tail: Characterization of amino acid variation
and tertiary structure of the tape measure protein
Anna E Morse, Brianna E Forrest, Garren R Granec, Emma D Ryan, Kayla M Fast, Tracy W Keener, Michael W
Sandel
Bacteriophages were isolated from soil samples using the bacterial host Mycobacterium smegmatis mc
2
155.
Instead of using a restriction enzyme digest to characterize phages before selecting which genomes to
sequence, we applied subcluster-specific PCR primers targeting the tape measure protein (TMP). By
comparing the sequenced products we determined whether phages matching to subclusters previously
discovered at the University of West Alabama (UWA) were novel or replicated. The F2 subcluster is highly
conserved across the TMP segment, and we could not determine whether our four F2 phages were unique or
identical. Conversely, TMP segments from other subclusters were informative and indicated that multiple,
unique phages from the same subcluster have been isolated at UWA. Our PCR results suggested that Sumter
was an A1 phage. We chose to sequence this genome because UWA had not annotated an A1 phage genome
before. The second phage, Candle, was selected because a cluster was not conclusively identified by PCR. The
genomes of Sumter and Candle are 52,656 bp and 71,390 bp long respectively. Annotation in PECAAN and
DNA Master identified 90 protein coding genes in Sumter and 96 in Candle. Next, we looked for patterns in
sequence variation within the A1 subcluster. To do so, we determined synonymous codon usage bias using
CAICAL and visualized protein sequence conservation in WebLogo for the following proteins: major tail protein,
TMP, minor tail protein, DNA primase, helix-turn-helix DNA binding domain, membrane protein, and immunity
repressor. Conservation of amino acids across members of the A1 subcluster was apparent in segments of the
major tail and minor tail proteins. The other proteins investigated showed higher amino acid variability. We
predicted protein tertiary structure for the seven genes listed above by using I-TASSER to match our amino
acid sequences to structures in Protein Data Bank (PDB). All phages found by UWA students were visualized
using a transmission electron microscope including members of the Siphoviridae and Myoviridae. Looking
collectively at the sequenced phages from UWA, we confirmed the previously identified correlation between
phage tail length and TMP length.
135
11thAnnualSEASymposiumAbstract
UniversityofWestFlorida
PensacolaFL
CorrespondingFacultyMember:Hui‐MinChung([email protected])
CassandraKelso
NaomiSemaan
AtaleofDOGEMS–lessonslearnedoutofM.foliorumphagehunting
CassandraKelso,AndrewBrown,KatelynCleveland,RileyDibble,PatrickLuciani,JamieMartinez,Sydney
Moore,GabrielleNorman,CassidyPaige,MalloryVining,WerleyRyan,NaomiSemaan,KarenBarnes,Kari
Clifton,Hui‐MinChung
ThispresentationistodiscussthestrategiesandsuccessofusingMicrobacteriumfoliorumasthebacterial
hostforphagehuntingandhowwefoundallphagestheirbelongedclusters.DOGEMS(DAH‐‐jums)standsfor
DeconvolutionofGenomesafterEnMasseSequencing.ItisamethodusedintheSEA‐PHAGEScommunityto
identifyclustersforapoolofphagesofinterest.Itinvolvestwoparts:1)EnMasseSequencing(sequencinga
convolutedmixtureofphageDNAs)and2)DeconvolutionofGenomes(usingoneorseveralexperimental
approachestode‐convolutebymatchingthecontigDNAsequencesobtainedfrompart1totheirrespective
inputphages.Theexperimentaldesignforpart2ingeneralincludes:a)blastingallthecontigstoidentify
phageclustersofinterest,b)designcluster‐specificprimersofPCRexperimentstotestallthephagesof
interest.Since2017wehaveusedtheDOGEMSmethodtoidentifyclustersforthephagesthatwerenot
chosenforphagegenomesequencing.Dependingonthelengthsofcontigsandprimerspecificities,our
successratesvariesfrom50%to100%.UsingM.foliorumasthehost,weemployeddirectisolationmethod
(37%successfulrate)andenrichedisolationmethod(7%successfulrate)forphagehunting.ThisyearusingM.
foliorumasthehost,weisolatedsixphagesbyemployingbothdirectisolationmethod(37%successfulrate)
andenrichedisolationmethod(7%successfulrate).WesequencedphagesSharkboy(inclusterEB)andAraxxi
(inclusterEM),andwereabletoIDtherestfourwiththeDOGEMSapproach:phagesBKfootlettuceand
FreshAvocadoinclusterEB,andphagesZeppandAlakazaminclusterEA5,bothnowhavetheirphagegenome
draftsintheActinobacteriophagedatabaseandPhamerator.Afewinterestingpointsemergedoutof
characterizingthesephagegenomes:1)WefoundBKfootlettuce,FreshAvocadoandSharkboyderivedfrom
136
thesamephageancestor,withlessthan1%differencesintheirgenomes.2)AlthoughZeppandAlakazam
wereisolatedfromthesoilsamplesofthesamecampus,AlakazamsharesmoresimilaritywithanotherEA5
phagediscoveredinNorthCarolina,Neferthena,thanwithZepp.3)TheAraxxigenomecontainsasuperbig
gene(gp27)thatencodesaproteinofapproximatelymorethan4,000aminoacidlong.Interestingly,notonly
theorthologsofthisgenewerefoundinEMphageBurroandafewEK1orEK2phageslikeArMaWen,
TinyTimothy,andAkoni,butalsopartiallyinahypotheticalgenefromPseudomonadalesbacterium.Wewill
discussourDOGEMSexperimentaldesignandthephagegenomecharacterizationinmoredetail.
137
11thAnnualSEASymposiumAbstract
UniversityofWisconsin‐RiverFalls
RiverFallsWI
CorrespondingFacultyMember:KarenKlyczek(karen.k.klyczek@uwrf.edu)
KaitlynLFields
ShawnaMLarson
Comparativegenomicsofphagesisolatedonnewhostspeciesreveals
novelgenomefeatures
KaitlynLFields,AhmedAbdullah,JoeAlexander,ChanelKCuneo,DavidCEnnest,DanielleErtsgaard,SarahB
Fields,KayleeJFritz,HelenaHumphreys,BradyTJohnson,JacobEKinneman,ShawnaMLarson,MeritN
Lemunyete,MoyaBMurray,NoahDNelson,EzekielKOlakunle,DelanyEOsmond,KellyAPatras,Sunny
Ransibrahmanakul,AmyCReimer,CallyCRobertson,GraceVRoss,KatieASimpson,BricarahSThull,Sam
Wetzel,JABonilla,KarenKKlyczek
UWRFphagehuntersexploredtherelationshipsbetweenphagesisolatedindifferenthostspecies.Weused
MicrobacteriumfoliorumNRRLB‐24224SEAandMicrobacteriumparaoxydansNRRLB‐14843,andalso
ArthrobacterglobiformisB‐2979.Eachsoilsamplewastestedonallthreehosts.From53samples,weisolated
49phages–13onM.foliorum,23onM.paraoxydans,and13onA.globiformis.Thegenomesof5phages
weresequenced:WaterT,LeeroyJenkins,andTyrumbrafromM.paraoxydans,andVibakiandQuifromA.
globiformis.WeidentifiedanadditionalthreephagesgenomessofarinaDOGEMSsample,includingHubbs
(M.foliorum),RubyRalph(M.paraoxydans),andShoya(A.globiformis).Weobservedavarietyofrelationships
betweenthesephagesandothersisolatedonvariousspeciesofMicrobacteriumandArthrobacter.Tyrumbra,
Hubbs,andRubyRalphhavesufficientnucleotidesimilaritywithotherphagestobeassignedtoclusters.
TyrumbraisinclusterEC,HubbsisinclusterED1,andRubyRalphisinclusterEG.Thesethreeclustersinclude
phagesisolatedonbothM.foliorumandM.paraoxydans.WaterTandLeeroyJenkinshadnonucleotide
similaritytootherphages,buttogethertheyformednewclusterGB.Theyshare96%nucleotideidentifyover
138
78%oftheirgenomes,and62.5%genecontentsimilarity.Thesephagegenomesare61,090‐62,439bplong,
with1545‐1807directterminalrepeats.TheiroverallgenomestructureissimilartotheclusterED1phages,
buttheyshareonly2phams.TheA.globiformisphagesareallSingletons,butarerelatedtophagesinexisting
clusters.Shoyashares25.5%genecontentsimilaritywithclusterFBphagesand27.5%similaritywithMaja,
anotherSingleton.Shoyaistheonlytemperatephagethatwefound,andweareisolatinglysogenstoconduct
immunitytestingwithotherArthrobacterphages.Vibakishares24‐26%genecontentsimilaritywiththe
clusterAOphages,andhasasimilarMyoviralmorphology.Quisharesabout20%genecontentsimilaritywith
clusterAMandAUphages.Ithasaprolatehead,liketheAMphages,butitsheadismuchlonger,150nmlong
and50nmwide.Itsgenomeis113,655bp,comparedto58,000‐59,000fortheAMandAUphages.Quialso
shares12‐20%genecontentsimilaritywithalargegroupofphagesfromdifferenthosts,includingclustersAW,
BI,CC,DJ,andEL.ThesephagesallhavelowG+C%content,severalgenesencodingmembraneproteins,and
manyintergenicrepeatsequences.ThereareseveralpairsoftandemlyrepeatedgenesinQui’sgenome,not
foundintheotherphages.Inaddition,manyQuigeneshaveblastphitstoothergenesintheQuigenome,
withevaluesof<10‐4,suggestingahistoryofgeneduplicationanddivergence.Theseobservationssuggest
geneduplicationasonepossiblemechanismfortheexpansionoftheQuigenomerelativetorelatedphages.
139
11th Annual SEA Symposium Abstract
Virginia Commonwealth University
Richmond VA
Corresponding Faculty Member: Allison Johnson ([email protected])
Nasita Islam
Phinding Phages & Bacteria Phrom James River Rockpools: A comparative
genome analysis
Nasita Islam, Sophia Fehrmann, Daanish Fiaz, Sukhleen Kaur, Rafa Khan, Mario Melchor-Guerra, Nevin Nguyen,
Allison A Johnson
Bacteriophages are undoubtedly great in number; the estimated 1031 members of the phage community are
biologically unique yet genomic characteristics among diverse phages may be conserved. In addition to their
fascinating diversity and features, their applications in phage therapy make them an important topic of study.
Analyzing phages, such as in our research project, allows for a greater understanding of phages as a
contribution to the ever-growing knowledge of their impact on our biosphere as well as potential use in phage
therapy.
Isolation of novel bacterial hosts from James River rockpools and using those hosts for phage discovery was
piloted during Summer 2018. Students in the 2018-19 VCU Phage Lab collected water from rockpools in the
James River in order to find phages and bacteria. Bacteria were isolated from the water in the rockpools by
streaking a plate, and restreaking until apparent homogeneity of colony appearance. Those novel isolates were
then used for phage discovery. Bacteriophages were isolated from river water through enrichment isolation
and purified by plaque assays. Multiple rounds of purification were conducted to ensure consistent plaque
morphology. A high titer lysate was then collected by flooding a webbed plate with phage buffer and filtering.
Phage particles were placed on electron microscopy grids and stained for visualization under a transmission
electron microscope. DNA was purified from lysate, and characterized by restriction digest enzymes. Two
phages, named Phynn and Kyle lysed our novel bacterial isolate Pantoea sp. A third phage, Beyonphe, lysed a
novel bacterial isolate Bacillus cereus.
The genomic DNA of these phages was sequenced. Following sequencing, students collaboratively
annotated the genomes. Bioinformatics tools, including DNA Master, HHpred, and Blastp along with reference
to Genemark coding predictions were used in order to analyze the genomes. While Pantoea phage Phynn, a
myoviridae, had a 173,720 base pair genome with circularly permuted ends, Kyle had a genome length of
73,168 base pairs with 3,603 base pair long terminal repeat. The Bacillus phage Beyonphe had a genome
length of 163450 bp and a 2154 bp long terminal repeat. Phynn had 263 open reading frames with two
different tRNAs as well as a 44.56% GC content, while Kyle had 109 open reading frames and zero tRNAs.
Phynn and Kyle have no significant similarity to each other, and little similarity to other sequenced phages in
140
Genbank. In contrast, Beyonphe had 292 open reading frames and no tRNAs, and significant conservation of
genome sequence and proteins to previously sequenced and annotated Bacillus-infecting phages. The relative
conservation of Bacillus phage genome sequences and proteins will be contrasted with the novelty of Pantoea
phage genome sequences and proteins through analysis using Bioinformatics tools.
141
11th Annual SEA Symposium Abstract
Virginia State University
Petersburg VA
Corresponding Faculty Member: Andrea Beyer ([email protected])
Sarah M Peebles
Discovery and Comparison of E Cluster Phages Infecting Microbacterium
foliorum
Sarah M Peebles, Kathryn H Shows, Brian L Sayre, Andrea R Beyer
Bacteriophage are the most abundant microbes on earth, at an estimated population of 10
31
particles.
However, their genomes are grossly underrepresented in sequence databases, and a large portion of their
genes are of unknown function. In order to gain a better understanding of phage diversity, novel viruses were
isolated and characterized from soil using an Actinobacter host. Microbacterium foliorum is a Gram-positive,
rod-shaped bacterium commonly found in soil and grass. Multiple bacteriophage were isolated from samples
originating at various locations on the campus of Virginia State University and from additional sites in Virginia
and North Carolina. Phage were isolated using both direct and enriched procedures, resulting in the discovery
of 10 phage which were further characterized by transmission electron microscopy. Eight samples were
successfully imaged; 5 were found to be the siphoviridae morphology, and 3 were podoviridae. Of these, DNA
was extracted from phage TeddyBoy, Owens, and SansAfet, and submitted for sequencing. The genomes were
subsequently annotated using PECAAN, DNA Master, HHPred, Phamerator, and Starterator. Though TeddyBoy
and Owens were found in distinct locations in Virginia, they are both in the same phage cluster (EE), share
similar genome sizes, and have a significant amount of overall sequence homology and shared synteny to one
another. They also bore a strong resemblance to EE draft phage BurtonThePup, isolated from Maryland.
Interestingly, TeddyBoy and SansAfet, which were isolated from different areas on the same farm in
Gloucester, VA, were found to be very distinct from one another. SansAfet was placed in cluster EB, and it
possessed a much larger and more complex genome, with multiple genes of unknown function. The results of
this study underline the remarkable diversity of phage within geographically similar locations, as well as the
intriguing similarities of phage isolated from spatially distant sites.
142
11th Annual SEA Symposium Abstract
Virginia Tech
Blacksburg VA
Corresponding Faculty Member: Stephanie Voshell ([email protected])
Brenna V DeBellas
Discovery of a recently described mobile element in novel
Mycobacteriophage Camri
Brenna V DeBellas, Stephanie M Voshell
Mycobacteriophages are genetically diverse viruses that infect bacteria in the Mycobacterium genus, which
includes both Mycobacterium tuberculosis and M. smegmatis. Due to the continued increase of antibiotic
resistance, researchers across the globe are revisiting old practices, such as phage therapy, to treat pathogenic
bacterial infections. Understanding bacteriophage genetics is crucial in the development of these phage
therapy treatments. The precise functions of the genes must be known in order to select the best phages to
target each strain of bacteria. The aim of the SEA-PHAGES program is to discover and characterize novel
bacteriophages using basic laboratory techniques and bioinformatic analyses to determine gene functions and
find novel features within each genome. The goal of this project was to annotate the genome of novel
bacteriophage Camri. Camri belongs to the G1 Subcluster and contains a unique genetic element only recently
discovered in a small number of mycobacteriophages. Camri’s genome contains a transposable element,
better known as an ultra-small Mycobacteriophage Mobile Element (MPME), in the latter section where
recombination typically occurs. The MPME in Camri’s genome is relatively small in length and matches the
MPME1 subcategory described in related phages. At this time, not much is known as to how these MPMEs
specifically affect mycobacteriophage genomes, but they have been shown to alter gene regulation and
expression in other organisms.
143
11th Annual SEA Symposium Abstract
Virginia Tech
Blacksburg VA
Corresponding Faculty Member: Stephanie Voshell ([email protected])
Stephanie M Voshell
A Unique Absentee: Mycobacteriophage Benvolio’s Lack of an Integrase
Gene
Stephanie M Voshell, Ryan R Adams, Lilly S Akbary, Michael B Andrews, Carly N Baumann, Joseph P
Belamarich, Priyanka S Bhuta, Caroline V Campbell, Cyrus K Crevits, Ciera R Crockett, Brenna V DeBellas,
Hannah E Dolan, Cassie L Ellis, Devon N Elsasser, Shannon L Fenwick, Rui Guo, Alexis R Jackson, Ashly Kaur,
Kelly A Madison, Sarah E Kivimaki, Arianna Y Martin, Samantha A McChesney, Megan R McCreary, Kylie J
McMahill, Mary K Nicely, Jessica B Ofsa, John D Redle, Michael R Santos, Katie B Stiltner, Annmarie C Taheny,
Phuong V Tran, Taylan Tunckanat, Aidan P Villavicencio, Kevin J Williams, Cale E Witmer, Eleanore H Woodruff
Mycobacteriophage Benvolio was isolated at Virginia Tech from local soil using Mycobacterium smegmatis as a
host. Benvolio produced slightly turbid plaques at 37° C and was assumed to be a temperate phage. All
evidence from characterization experiments including PCR of the tape measure protein gene, tail length, and a
restriction digest suggested that Benvolio belonged to the A2 subcluster. Genome sequencing revealed that
Benvolio was indeed a member of the A2 subcluster and that the phage lacks an integrase gene. The majority
of A2 phages, including several of Benvolio’s close relatives, have an integrase gene making them capable of
utilizing the lysogenic cycle (temperate phage). Benvolio, like closely related Echild, contains ParA and ParB
genes close to the location of the missing integrase gene. The ParAB genes are believed to form a putative
partitioning cassette which conveys the ability to form lysogens. Lytic phages are sought after as candidates
for phage therapy since they are more likely to destroy the target bacteria rapidly. Benvolio warrants further
study to determine whether or not it can truly form stable lysogens without an integrase gene.
144
11th Annual SEA Symposium Abstract
Virginia Western Community College
W. Roanoke VA
Corresponding Faculty Member: Heather Lindberg ([email protected])
Elizabeth Burrell
The Isolation of Barry and the Genome Analysis of three A cluster
mycobacteriophages: Dr.FeelGood, SoilDragon and NothingSpecial.
Heather Lindberg, Elizabeth Burrell
At Virginia Western Community College, over the course of the 2018- 2019 academic year, we isolated Barry, a
unique bacteriophage with a prolated capsid head. Barry was isolated from soil collected in the Roanoke Valley
using Mycobacterium smegmatis mc155 as the host bacterium. Unfortunately, we were unable to successfully
separate Barry from another siproviridae phage, meaning we were unable to submit Barry for sequencing.
Instead, we annotated two A cluster phages, SoilDragon and Nothing Special. We chose to annotate these
cluster A phages in order to compare them to DrFeelGood, which was annotated here at VWCC last year.
SoilDragon and NothingSpecial share more similarity to each other than either share with DrFeelGood. Most of
the similarity lies in the left side of the genome, which is not unexpected, given that much of the left side of
the genome contains the genes needed for capsid development. Hopefully, through continued comparisons
between annotated phages, we will be able to gain a deeper understanding of phage genetics and the
evolutionary pressures which have shaped the genomes we see.
145
11th Annual SEA Symposium Abstract
Washington University in St. Louis
St. Louis MO
Corresponding Faculty Member: Chris Shaffer ([email protected])
Nitan Shalon
Analysis of Six Novel Bacteriophages Isolated from the St. Louis Area
Nitan Shalon, Members of Bio 192
Students at Washington University in St. Louis isolated six novel bacteriophages from the greater St. Louis
area: Zuko, Phettuccine, Issmi, Bmoc, Kardashian, and Saftant. Analysis of these phage genomes contributes to
the understanding of phage ecology in St. Louis, MO and the set of phages capable of infecting Streptomyces
griseofuscus. The bacteriophages were isolated using a plaque assay, and their morphology characterized by
transmission electron microscopy. Each phage was then sequenced using shotgun sequencing and
subsequently annotated. The bacteriophages were placed into clusters BI, BE1, BD2, BD1, BD3, and one was in
a singleton. Kardashian’s BI subcluster is still being finalized, and may belong to a new, fifth subluster. Through
a BLASTn query on PhagesDB, Zuko’s 82,302 bp genome has only 0.25% of its genome align to its most similar
phage (Nesbitt). Due to Zuko’s dissimilarity, it was placed into a singleton cluster, 64.5% of its putative proteins
assigned unknown function, and many of its expected structural proteins remain unidentified. Bmoc has a
large 132,885 bp genome, appears to have a lytic lifestyle, and includes an array of 41 tRNA’s and 1 tmRNA.
Despite Bmoc’s similarity with other BE1 cluster phages, there were only 61 identifiable proteins within its 239
genes. Saftant displays strong synteny with other BD3 cluster phages and contains an Ocr antirestriction
protein, which has not been previously described in PhagesDB, that inhibits type I restriction and modification
systems. Within this group, Phettuccine and Issmi are the two most similar phages, and have a 49,530 bp
genome with 73 genes and a 50,643 bp genome with 79 genes respectively.
146
11th Annual SEA Symposium Abstract
Washington University in St. Louis
St. Louis MO
Corresponding Faculty Member: Chris Shaffer ([email protected])
Christopher D Shaffer
The inner workings and future directions for Starterator
Christopher D Shaffer
Starterator is a python 2.7 program originally written in the Hatfull lab by Marissa Pacey led by Dan Russell. It
is designed to characterize the evolutionary context of possible start codons among a collection of orthologous
genes. By using multiple sequence alignments of genes from all members of a pham the level of conservation
and position of annotated start codons is visualized and the results can be used as evidence for start codon
annotations of new pham member genes. This poster will present a view of the inner workings of Starterator
including the underlying algorithms, it will also discuss how the results of these algorithms are presented in the
graphical and textual output. Finally, examples of possible future changes will be presented and requests for
user input will be elicited.
147
11th Annual SEA Symposium Abstract
Western Carolina University
Cullowhee NC
Corresponding Faculty Member: Maria Gainey ([email protected])
Genetic Diversity and Surprising Host Range of Fourty-Two
Microbacteriophages Isolated at Western Carolina University
Brooklynn Herold, Megan Eckardt, Jamie Wallen, Maria Gainey
Western Carolina University (WCU) has been a part of the SEA-PHAGES program for the past four years.
During this time WCU students have isolated and archived 84 Actinobacteriophages. The bacterial host
Microbacterium foliorum has been used for virus isolation for the past two years. In 2017, twenty
Microbacteriophages were isolated and archived but initial discovery was slow with many students performing
multiple rounds of spot tests. However, in 2018 due to an increase in calcium during enrichment over half the
class isolated a Microbacteriophage after only one attempt. A total of twenty-two Microbacteriophages were
isolated and archived by WCU students in 2018. The Microbacteriophages discovered in 2018 had very
different characteristics than those discovered in the previous year. Three of these bacteriophages Slentz, Ciel,
and FuzzBuster were selected for whole genome sequencing. All three bacteriophages belong to the family
Siphoviridae. Surprisingly, Slentz and Ciel’s genomes were only 17,445 bp long and were classified as cluster EE
bacteriophages. Cluster EE bacteriophages have the smallest genomes of any cluster of Actinobacteriophages
and encode little else besides structural proteins. FuzzBuster’s genome was 54,844 bp long and was classified
as a singleton with some similarity to cluster EI bacteriophages. Our class also performed an additional host-
range experiment using Microbacterium aerolatum, Microbacterium paraoxydans, and Microbacterium
testaceum obtained from the Hatfull laboratory. Excitingly, FuzzBuster and three other bacteriophages
discovered in 2018 were able to infect Microbacterium testaceum. We were even more surprised to discover
that two cluster EA2 bacteriophages sequenced in 2017 (Andromedas and ColaCorta) readily infected all
Microbacterium species tested. These results and the cation dependency of Microbacteriophages
demonstrating expanded host range will be discussed.
148
11th Annual SEA Symposium Abstract
Western Kentucky University
Bowling Green KY
Corresponding Faculty Member: Claire Rinehart ([email protected])
Matthew P Johnson
Summary Of: Microbacterium Phages Clancy (EA1) & LilyLou (EK1);
Arthrobacter Phage JEGGS (AM); Gordonia Phage Tangerine (DE1); and
Mycobacterium Phages Mahavrat (F1), GroupThink (A3) & WideWale (A2).
Matthew P Johnson, Lily J Berry, Elizabeth K Guernsey, Wren A Jenkins, Deeya D Patel, Colleen S Jackson, Katie
L Alexander, Sai P Boyareddygari, Jacquelyn V Buckley, Austin B Byrn, Norman T Chan, Akenpaul S Chani,
Natalie G Cooper, Amara N Danturthi, Stephanie D Espinoza, Miranda L Estes, Edwin J Fields, Kacie N Gaekle,
Brittney N Hackworth, Ansley N Harmon, Brandon C Hodge, Braden M Johnson, Matthew J Jones, Kelsey M
Littrell, Lorenzo M Mahoney, Shifa Maryyam, Emily A McAffe, Grace M McClurg, Adam T McMahon, Logan O
Mingus, Jacob M Moore, Elizabeth A Morgan, Maunil Mullick, Lukas R Negron, William J Newton, Hasitha
Ramisetti, Johnthomas P Reagor, Miriam C Richardson, Nicholas R Sabotchick, Anna T Simpson, Hannah M
Suter, Eleanor D Tarter, Matthew H Tauchert, Elisha P VanZant, Adrienne E Werle, Austin K White, Hope E
Williams, Ashley K Wright, Bobby L Gaffney, Amanda K Staples, Naomi S Rowland, Rodney A King, Claire A
Rinehart
Phages Clancy (EA1) and LilyLou (EK1) were isolated from mud and soil samples respectively, and were then
enriched with Microbacterium foliorum where both exhibited turbid plaques. Even though the plaques were
turbid, neither phage has an identifiable integrase nor repressor gene. Clancy is a Siphoviridae morphotype
with a head diameter of 43 nm and tail length of 133 nm. LilyLou is a Podoviridae morphotype with a head
diameter of 47 nm and a tail length of 17 nm. Clancy has a genome length of 41,555 bp and encodes 62 genes.
LilyLou has a genome length of 54,388 bp and encodes 56 genes. Clancy is related to a large number of EA1
phages but LilyLou only matches one published phage, ArMaWen, another EK1 phage. An interesting feature
of LilyLou, and other EK1 phages, is the length of gene 33 (13,482 bp coding for 4493 amino acids) which has
no known function. EK1 phages have few known functions, not even a capsid nor protein.
JEGGS was isolated from a soil sample and enriched on Arthrobacter sp. ATCC 21022 and belongs to the AM
cluster. It has a prolate head 37 x 60 nm and a 213 x 13 nm Siphoviridae type tail. It has a genome length of
58,287 bp that encodes 100 genes. It is a lytic phage but exhibits turbid plaques. It is most closely related to
Heisenberger and Mudcat which also have prolate heads.
149
Tangerine was isolated from a soil sample and enriched on Gordonia terrae and belongs to the DE1 cluster. It
is a member of the Siphoviridae family but has a flattened head that is 61 nm wide and 51 nm high (along the
axis of the tail). The tail is 233 nm in length. Tangerine is a lytic phage and shows clear plaques with hazy halos
near the edge of the plaque. It has a genome length of 57,306 bp and encodes 85 genes. It is related to the
phage Ashertheman.
Mahavrat was isolated from a moist soil sample and was enriched and isolated using Mycobacterium
smegmatis mc²155 as the host. Mahavrat belongs to the F1 cluster. It has a Siphoviridae morphology with a
head diameter of 48 nm and a tail length of 308 nm. Mahavrat is a temperate phage with a genome of 55,945
bp. It has fairly clear plaques at 30°C.
GroupThink was isolated from a soil sample and was enriched and isolated using Mycobacterium smegmatis
mc²155 as the host. GroupThink belongs to the A3 cluster. It has a Siphoviridae morphology with a head
diameter of 42 nm and a tail length of 118 nm. GroupThink is a temperate phage with large cloudy plaques.
The genome is 50,574 bp long and codes for 86 proteins and 3 tRNAs. Except at 29 bp, GroupThink is identical
to Heliosoles.
WideWale was isolated from a soil sample and was enriched and isolated using Mycobacterium smegmatis
mc²155 as the host. WideWale belongs to the A2 cluster with a Siphoviridae morphology that has a head
diameter of 38 nm and a tail length of 103 nm.
The genome is 53,040 bp long and is identical to phages Equemioh13 and Updawg except at 6 an 10 bp
respectively. It codes for 97 genes and 1 tRNA.
150
11th Annual SEA Symposium Abstract
Winthrop University
Rock Hill SC
Corresponding Faculty Member: Kristi Westover ([email protected])
Bethany M Wise
Host range investigation of novel bacteriophages, Rhysand, Scamander,
and MonChoix, Microbacterium foliorum bacteriophages isolated from the
North Catawba River Region
Bethany M Wise, Hallie V Smith, Ann M Cannon, Carlos E Escoto-Diaz, Justice T Dixon, Katelyn Driggers,
Christine M Dunn, Erin Emiroglu, Amanda J Foster, Braylan Jackson, Erin E Kelly, Nate C Kidd, Ellery S McNeill,
Savannah A Scott, Jared T Small, Allison T Smith, Allison M Stanek, Kristi M Westover, Victoria J Frost
This is the 3rd year Winthrop University has offered a two-semester undergraduate research course as part of
the SEA-PHAGES (Science Education Alliance-Phage Hunters Advancing Genomics and Evolutionary Science)
program sponsored by the HHMI Science Education Alliance. During the fall 2018 semester, students focused
on isolating and identifying unique bacteriophages using Microbacterium foliorum as the bacterial host. All
samples were isolated from the North Catawba River Region. Individual phages were purified to obtain
identical plaque morphologies and then amplified to collect high viral titer (HVT) lysates. Phage DNA was
isolated and cut using restriction enzymes in tandem with a Phage Enzyme Tool (PET). DNA gel electrophoresis
was used to display the DNA fingerprints of the individual phages; their patterns were then uploaded onto the
PET program to predict the cluster of a phage. Two phages with high titer lysates and unique restriction digest
patterns; Rhysand and MonChoix, were sent to the University of Pittsburgh for DNA sequencing. The genome
annotations were performed at Winthrop University, Rock Hill, SC. Rhysand is a member of the EE cluster and
contains 25 open reading frames. Its genome is 17,453bp in length with a GC content equal to 68.7%. We
identified a -1 frameshift in the tail assembly chaperone proteins which is characteristic of all other annotated
members of the EE cluster. MonChoix is a member of the EA cluster, and a member of the EA1 sub-cluster.
MonChoix has 63 open reading frames and is 41,670bp in length, with a GC content equal to 63.4%. Members
of the EA1 sub cluster are not known to contain frameshifts in the tail assembly chaperone proteins, in
contrast to other members of the EA cluster. To investigate host range, these phages as well as a previously
characterized WU microbacterium phage, Scamander, were tested to see whether they have the ability to
infect other bacteria from the Actinobacteria phylum. The hosts include Microbacterium liquefaciens,
Microbacterium paraoxydans and Microbacterium testaceum. Initial spot titers showed signs of infection on
alternative hosts by three of the 17 phages. To date, Scamander and Rhysand appear specific for their host and
MonChoix exhibits a wider host range. Comparative analysis at the genome level and further testing
phenotypically will help elucidate whether these newly discovered phages use a specific host to replicate or
whether mutants exist that have the advantageous ability to infect a variety of bacterial hosts in their
151
microbial community. This work adds to the increasing knowledge of bacteriophage biology and host-phage
evolution, which is also relevant to the control of bacterial infectious disease.
152
11th Annual SEA Symposium Abstract
Worcester Polytechnic Institute
Worcester MA
Corresponding Faculty Member: JoAnn Whitefleet-Smith ([email protected])
Devin G Cunningham
Comparative Genomics of EF Cluster Microbacterium foliorum
Bacteriophages NarutoRun and Anakin
Devin G Cunningham, Joseph G Crognale, Haylea T Northcott, Chloe A Sairs, Meadow R Wicke, Michael J
Aquino, Vivian C Nguyen, Jennifer A Payano, Parker J Simpson, Yueqing Wang
At Worcester Polytechnic Institute, two SEA-PHAGES sponsored lab sequences were conducted, resulting in
the isolation of two novel EF cluster phages: NarutoRun and Anakin. First, a bacteriophage isolation and
amplification lab was conducted in Fall 2018, followed by a bioinformatics lab in which the genetic sequences
of the two phages were annotated and compared to each other, other EF cluster bacteriophages, and to
bacteriophages of differing clusters. The two sequenced phages were both isolated from Worcester’s Institute
Park, with Anakin obtained from a highly trafficked area and NarutoRun from a secluded, grassy location close
to the edge of a pond.
Examining the EF cluster bacteriophages, seven genes with known functions were identified to be unique to
this cluster. Of these seven two genes are tail-related, two are nondescript membrane proteins, one is the
capsid maturation protease, one is an unusual DNA primase, and the last is a RuvC-like resolvase. These seven
genes are present in all members of the EF cluster, but no other non-EF bacteriophages.
Upon genetic sequencing, it was discovered that both phages had circularly permuted genomes, and were
identical aside from two differing nucleotides, both of which were in coding regions. The first substitution is
located in a tail assembly protein, and was ultimately synonymous. The second substitution is located in a
RuvC-like resolvase, and was nonsynonymous. This RuvC-like resolvase was of particular interest due to its
exclusivity to the EF cluster of bacteriophages, and thus its role in regards to the management of these phages’
circular genomes was investigated. With only a single nonsynomyous difference between the NarutoRun and
Anakin bacteriophages, evidence therefore supports the claim that they are functionally identical phages.
153
11th Annual SEA Symposium Abstract
Xavier University of Louisiana
New Orleans LA
Corresponding Faculty Member: Joe Ross ([email protected])
Majesty A Mason
Fun with Donkeykong: more phaging on (or at least near...) the bayou
Tai M Bowling-Charles, Raimel H Brooks, Katie T Dang, Altonnesha T Darby, Peyton A Goings, Maya N Johnson,
Kyelin A Knowles, Majesty A Mason, Angela Nguyen, Ayesha Tabassum, Tristan T Tran, Christopher J Webb,
Joseph F Ross
Phages were isolated from a variety of locales in and around the Greater New Orleans, Louisiana area using
standard microbiological techniques. Genomic DNAs from two phages were sequenced and one genome, that
of Donkeykong, was chosen for analysis. The sequenced genome is 59,478bp in length, with cohesive ends
showing a ten base pair overlap. BLASTn analysis reveals considerable nucleotide homology with the genomes
of other known mycobacteriophages in cluster F, subcluster F1. Automated annotation employing Glimmer,
GeneMark and Aragorn in the DNAMaster environment calls about 106 features, all presumptively encoding
protein; no tRNA genes are predicted. Presumed lack of tRNAs and tmRNAs is confirmed by analyses run with
both “external” Aragorn (i.e. via the World Wide Web external to the DNAMaster environment) and
tRNAScanSE. With the help of BLASTp analysis and similar tools, it is possible to make at least tentative
proposals for the functions of possible gene products in the case of a significant minority of putative protein-
encoding ORFs. The structure of the genome appears to be similar to that of many mycobacteriophages, with
ORFs that at least potentially encode structural products at the left end, while the right end has a more
complex and difficult to predict functional picture.
154
